15,000+++ Health Professionals On Covid / Covid_19, Covid-19, Cornavirus 19 - Well Researched Posts

Discussion in 'OFF TOPIC SUBJECTS' started by CULCULCAN, Mar 11, 2021.

  1. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    Bombshell - Former Pfizer VP

    - ‘Entirely Possible This Will Be Used

    for Massive-Scale Depopulation’


    https://beforeitsnews.com/eu/2021/0...d-for-massive-scale-depopulation-2670101.html






    Bombshell - Former Pfizer VP - ‘Entirely Possible This Will Be Used for Massive-Scale Depopulation’
    Tuesday, March 30, 2021 5:41




    101Shares
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]


    by tts-admin | Mar 30, 2021 | 1 comment
    mike-yeadon-former-science-officer-for-Pfizer-says-pandemic-is-over-1080x675.
    by Mordechai Sones – America’s Frontline Doctors March 25, 2021

    America’s Frontline Doctors (AFLDS) spoke to former Pfizer Vice President and Chief Science Officer Dr. Mike Yeadon about his views on the COVID-19 vaccine, hydroxychloroquine and ivermectin, the regulatory authorities, and more.

    At the outset, Dr. Yeadon said “I’m well aware of the global crimes against humanity being perpetrated against a large proportion of the worlds population.

    “I feel great fear, but I’m not deterred from giving expert testimony to multiple groups of able lawyers like Rocco Galati in Canada and Reiner Fuellmich in Germany.

    “I have absolutely no doubt that we are in the presence of evil (not a determination I’ve ever made before in a 40-year research career) and dangerous products.


    “In the U.K., it’s abundantly clear that the authorities are bent on a course which will result in administering ‘vaccines’ to as many of the population as they can. This is madness, because even if these agents were legitimate, protection is needed only by those at notably elevated risk of death from the virus. In those people, there might even be an argument that the risks are worth bearing. And there definitely are risks which are what I call ‘mechanistic’: inbuilt in the way they work.

    “But all the other people, those in good health and younger than 60 years, perhaps a little older, they don’t perish from the virus. In this large group, it’s wholly unethical to administer something novel and for which the potential for unwanted effects after a few months is completely uncharacterized.

    “In no other era would it be wise to do what is stated as the intention.

    “Since I know this with certainty, and I know those driving it know this too, we have to enquire: What is their motive?

    “While I don’t know, I have strong theoretical answers, only one of which relates to money and that motive doesn’t work, because the same quantum can be arrived at by doubling the unit cost and giving the agent to half as many people. Dilemma solved. So it’s something else.
    Appreciating that, by entire population, it is also intended that minor children and eventually babies are to be included in the net, and that’s what I interpret to be an evil act.

    “There is no medical rationale for it. Knowing as I do that the design of these ‘vaccines’ results, in the expression in the bodies of recipients, expression of the spike protein, which has adverse biological effects of its own which, in some people, are harmful (initiating blood coagulation and activating the immune ‘complement system’), I’m determined to point out that those not at risk from this virus should not be exposed to the risk of unwanted effects from these agents.”


    AFLDS: The Israel Supreme Court decision last week cancelling COVID flight restrictions said: “In the future, any new restrictions on travel into or out of Israel need, in legal terms, a comprehensive, factual, data-based foundation.”

    In a talk you gave four months ago, you said

    “The most likely duration of immunity to a respiratory virus like SARS CoV-2 is multiple years. Why do I say that? We actually have the data for a virus that swept through parts of the world seventeen years ago called SARS, and remember SARS CoV-2 is 80% similar to SARS, so I think that’s the best comparison that anyone can provide.

    “The evidence is clear: These very clever cellular immunologists studied all the people they could get hold of who had survived SARS 17 years ago. They took a blood sample, and they tested whether they responded or not to the original SARS and they all did; they all had perfectly normal, robust T cell memory. They were actually also protected against SARS CoV-2, because they’re so similar; it’s cross immunity.

    “So, I would say the best data that exists is that immunity should be robust for at least 17 years. I think it’s entirely possible that it is lifelong. The style of the responses of these people’s T cells were the same as if you’ve been vaccinated and then you come back years later to see if that immunity has been retained. So I think the evidence is really strong that the duration of immunity will be multiple years, and possibly lifelong.”

    In other words, previous exposure to SARS – that is, a variant similar to SARS CoV-2 – bestowed SARS CoV-2 immunity.

    The Israel government cites new variants to justify lockdowns, flight closures, restrictions, and Green Passport issuance. Given the Supreme Court verdict, do you think it may be possible to preempt future government measures with accurate information about variants, immunity, herd immunity, etc. that could be provided to the lawyers who will be challenging those future measures?

    Yeadon: “What I outlined in relation to immunity to SARS is precisely what we’re seeing with SARS-CoV-2.
    The study is from one of the best labs in their field.


    “So, theoretically, people could test their T-cell immunity by measuring the responses of cells in a small sample of their blood. There are such tests, they are not “high throughput” and they are likely to cost a few hundred USD each on scale. But not thousands. The test I’m aware of is not yet commercially available, but research only in U.K.

    “However, I expect the company could be induced to provide test kits “for research” on scale, subject to an agreement. If you were to arrange to test a few thousand non vaccinated Israelis, it may be a double edged sword. Based on other countries experiences, 30-50% of people had prior immunity & additionally around 25% have been infected & are now immune.

    “Personally, I wouldn’t want to deal with the authorities on their own terms: that you’re suspected as a source of infection until proven otherwise. You shouldn’t need to be proving you’re not a health risk to others. Those without symptoms are never a health threat to others. And in any case, once those who are concerned about the virus are vaccinated, there is just no argument for anyone else needing to be vaccinated.”

    My understanding of a “leaky vaccine” is that it only lessens symptoms in the vaccinated, but does not stop transmission; it therefore allows the spread of what then becomes a more deadly virus.

    For example, in China they deliberately use leaky Avian Flu vaccines to quickly cull flocks of chicken, because the unvaccinated die within three days. In Marek’s Disease, from which they needed to save all the chickens, the only solution was to vaccinate 100% of the flock, because all unvaccinated were at high risk of death. So how a leaky vax is utilized is intention-driven, that is, it is possible that the intent can be to cause great harm to the unvaccinated.

    Stronger strains usually would not propagate through a population because they kill the host too rapidly, but if the vaccinated experience only less-serious disease, then they spread these strains to the unvaccinated who contract serious disease and die.

    Do you agree with this assessment? Furthermore, do you agree that if the unvaccinated become the susceptible ones, the only way forward is HCQ prophylaxis for those who haven’t already had COVID-19?

    Would the Zelenko Protocol work against these stronger strains if this is the case?

    And if many already have the aforementioned previous “17-year SARS immunity”, would that then not protect from any super-variant?

    “I think the Gerrt Vanden Bossche story is highly suspect. There is no evidence at all that vaccination is leading or will lead to ‘dangerous variants’. I am worried that it’s some kind of trick.

    “As a general rule, variants form very often, routinely, and tend to become less dangerous & more infectious over time, as it comes into equilibrium with its human host. Variants generally don’t become more dangerous.

    “No variant differs from the original sequence by more than 0.3%. In other words, all variants are at least 99.7% identical to the Wuhan sequence.

    “It’s a fiction, and an evil one at that, that variants are likely to “escape immunity”.

    “Not only is it intrinsically unlikely – because this degree of similarity of variants means zero chance that an immune person (whether from natural infection or from vaccination) will be made ill by a variant – but it’s empirically supported by high-quality research.

    “The research I refer to shows that people recovering from infection or who have been vaccinated ALL have a wide range of immune cells which recognize ALL the variants.

    “This paper shows WHY the extensive molecular recognition by the immune system makes the tiny changes in variants irrelevant.

    “I cannot say strongly enough: The stories around variants and need for top up vaccines are FALSE. I am concerned there is a very malign reason behind all this. It is certainly not backed by the best ways to look at immunity. The claims always lack substance when examined, and utilize various tricks, like manipulating conditions for testing the effectiveness of antibodies. Antibodies are probably rather unimportant in host protection against this virus. There have been a few ‘natural experiments’, people who unfortunately cannot make antibodies, yet are able quite successfully to repel this virus. They definitely are better off with antibodies than without. I mention these rare patients because they show that antibodies are not essential to host immunity, so some contrived test in a lab of antibodies and engineered variant viruses do NOT justify need for top up vaccines.

    “The only people who might remain vulnerable and need prophylaxis or treatment are those who are elderly and/or ill and do not wish to receive a vaccine (as is their right).

    “The good news is that there are multiple choices available: hydroxychloroquine, ivermectin, budesonide (inhaled steroid used in asthmatics), and of course oral Vitamin D, zinc, azithromycin etc. These reduce the severity to such an extent that this virus did not need to become a public health crisis.”

    Do you feel the FDA does a good job regulating big pharma? In what ways does big pharma get around the regulator? Do you feel they did so for the mRNA injection?

    “Until recently, I had high regard for global medicines regulators. When I was in Pfizer, and later CEO of a biotech I founded (Ziarco, later acquired by Novartis), we interacted respectfully with FDA, EMA, and the U.K. MHRA.
    Always good quality interactions.


    “Recently, I noticed that the Bill & Melinda Gates Foundation (BMGF) had made a grant to the Medicines and Healthcare products Regulatory Agency (MHRA)! Can that ever be appropriate? They’re funded by public money. They should never accept money from a private body.

    “So here is an example where the U.K. regulator has a conflict of interest.

    “The European Medicines Agency failed to require certain things as disclosed in the ‘hack’ of their files while reviewing the Pfizer vaccine.

    “You can find examples on Reiner Fuellmich’s “Corona Committee” online.

    “So I no longer believe the regulators are capable of protecting us. ‘Approval’ is therefore meaningless.

    “Dr. Wolfgang Wodarg and I petitioned the EMA Dec 1, 2020 on the genetic vaccines. They ignored us.

    “Recently, we wrote privately to them, warning of blood clots, they ignored us. When we went public with our letter, we were completely censored. Days later, more than ten countries paused use of a vaccine citing blood clots.

    “I think the big money of pharma plus cash from BMGF creates the environment where saying no just isn’t an option for the regulator.

    “I must return to the issue of ‘top up vaccines’ (booster shots) and it is this whole narrative which I fear will he exploited and used to gain unparalleled power over us.

    “PLEASE warn every person not to go near top up vaccines. There is absolutely no need to them.

    “As there’s no need for them, yet they’re being made in pharma, and regulators have stood aside (no safety testing), I can only deduce they will be used for nefarious purposes.


    “For example, if someone wished to harm or kill a significant proportion of the worlds population over the next few years, the systems being put in place right now will enable it. “It’s my considered view that it is entirely possible that this will be used for massive-scale depopulation.”
    Source

    Bombshell - Former Pfizer VP

    - ‘Entirely Possible This Will Be Used

    for Massive-Scale Depopulation’


    https://beforeitsnews.com/eu/2021/0...d-for-massive-scale-depopulation-2670101.html

    CHECK OUT THE COMMENTS !!!

    HERE ARE A FEW OF THEM

    • beLIEve
      28 July 2015
      WHO (World Health Organisation) MEMO$ from 1972 explain how to TURN VACCINES INTO A MEAN$ of KILLING. . First published 2009. icon_mad.
      CORONAVIRU$ Isolated From Humans, PATENT Timeline icon_idea.
      Why Are We In Lockdown-As Of 19 March 2020, COVID-19 Is No Longer Considered To Be A High Consequence Infectious Disease (HCID) In The UK
      https://thebridgelifeinthemix.info/...high-consequence-infectious-diseases-hcid-uk/
      100 BULLET POINT FACT$ to show the C – 19 is BASED entirely ON FICTION: icon_lol.
      https://thebridgelifeinthemix.info/british-law/evidence-covid-19-pandemic-false/
      It needs to be understood that the UNITED NATIONS is a ROTH$CHILD creation and acts as the WORLD government FOR the BANK$.
      It is now time to demolish it so that I$RAEL, another ROTH$CHILD CREATION, can form a NEW GLOBAL GOVERNMENT in I$RAEL under the TALMUDIC NOAHIDE PLATFORM. icon_mad. This is the role of KING CYRUS, to emancipate the supremacist’s that control I$RAEL and GIVE THEM the WORLD UNDER MEDICAL DICTATORSHIP. Now you can understand the current PANDEMIC as the means to UPROOTING the UN.
      Those that formed the following agenda will also CONTROL the NEW PLATFORM IN I$RAEL and of course will continue everything achieved by the UNITED NATION$ and it’$ ….WORLD HEALTH ORGANI$ATION. BILL GATES I$ a front for the CIA, the Rockefellers and ultimately the Rothschilds. DO NOT BE DECEIVED. icon_idea.
      LOCKDOWN News icon_idea.
      Two KEY MEMORANDUM$ from the World Health Organisation, (WHO)…….
      MAR 30, 2021, 7:13 AM upvote. downvote. spam. 0Reply

      • default_avatar. beLIEve
        ……CONTINUED….from my incomplete post above……. icon_idea. icon_idea. icon_idea.
        LOCKDOWN NEWS icon_idea.
        Two KEY MEMORANDUM$ from the World Health Organisation, (WHO) discovered by PATRICK JORDAN, show the WHO has INTENTIONALLY CREATED the three-shot KILLER VACCINE, icon_mad. with the intent under pandemic regulations, to FORCE PEOPLE to TAKE A$ MANDATORY under some FANTA$Y CORPORATE DECLARED MELTDOWN. icon_idea.
        It is the CONTINGENCY ACT 2004 in the U.K., the PATRIOT ACT in the U.S. with all other nations under the U.N. controlled insolvency administration platforms having there own version, that the incorporated governments will MOVE TO ENFORCE the MADNE$$ you are going to read about in this report. icon_idea.
        Many statutes were changed during the 2009 flu script that will allow the State to enforce vaccinations under the mental health platform you promote with vigour, without recognising the SHADOW AGENDA ready to become the icon_idea. RULES icon_lol. OF the CORPORATE STATE. icon_idea.
        Pandemic Influenza Preparedness Framework, PDF icon_idea.
        UNDERSTAND one thing, all this Legal LEGISLATION applies only to the Person, it HAS NO JURISDICTION IN the WORLD OF MAN. icon_idea. Study :

        View: https://www.youtube.com/watch?v=LD4fNy2T3cg&t=5s

        1972 WHO Bulletin 47, No 2 Memoranda #1 and #2 icon_idea.
        Virus-associated immunopathology :
        ANIMAL MODELS and implications for human disease technically outline the ability to CREATE BIOLOGICAL WEAPONS IN the FORM of VACCINES…….THAT………
        MAR 30, 2021, 7:14 AM upvote. downvote. spam. 0Reply

        • default_avatar. beLIEve
          ……CONTINUED….from my incomplete post above……. icon_idea. icon_idea. icon_idea.
          ANIMAL MODELS and implications for human disease technically outline the ability to CREATE BIOLOGICAL WEAPONS IN the FORM of VACCINES…….THAT…… CREATE…. icon_idea.
          1) TOTALLY DISABLE the IMMUNE SYSTEM. icon_idea.
          2) LOAD EVERY CELL of …VICTIM’$….BODY WITH…INFECTION…. icon_mad.
          3) SWITCH the IMMUNE SYSTEM ON….CAUSING…the HOST TO KILL THEMSELVES….IN A CYTOKINE STORM.
          ONE, TWO, THREE, DEAD. icon_redface.
          These WHO Memoranda’s describe the THREE-STAGE IMPACT OF the THREE SHOTS many people will be forced to take in the autumn to allegedly treat a virus that WHO also helped create and release.
          This is a crucial piece of evidence of WHO’s long-term intentions because these memorandums give the best and fullest insight into the WHO and AFFILIATED LABS, (such as the CDC) and their current activities, activities such as the patenting of the most lethal bird flu viruses available, and sending the virus to BAXTER’$ subsidiary in AUSTRIA, which WEAPONISED IT…AND…SENT OUT 72 KILOS TO 16 LABS IN FOUR COUNTRIES ALMOST TRIGGERING….A GLOBAL PANDEMIC. icon_idea. icon_idea. icon_mad.
          For every CRIME, there needs to be MOTIVE, an indication that it was deliberate, A PLANNED EVENT. icon_idea. The WHO MEMORANDUM$ PROVIDE the EVIDENCE icon_idea. OF just such a DELIBERATE LONG-TERM PLANNING TO KILL PEOPLE icon_mad. BY WEAKENING THEIR IMMUNE SYSTEM by use of the FIRST VACCINE……. INJECTING
          A LIVE VIRUS INTO the BODY BY a SECOND….AND….. CREATING A CYTOKINE STORM……USING SQUALENE and NAGALESE IN a THIRD. icon_mad.
          Video available here : https://153news.net/watch_video.php?v=SD2N7HWB4H2O
          Download the WHO Memoranda on : here icon_redface.
          How did we arrive at 2020 :
          Scroll down the PDF until you find : icon_redface.
          CLICK on LINK below for full article……. icon_idea.
          https://thebridgelifeinthemix.info/...how-to-turn-vaccines-into-a-means-of-killing/
          MAR 30, 2021, 7:15 AM upvote. downvote. spam. 0Reply

    • 768938cf70485161bd1b318fcb6ab1a61f9fc9fa. pocomotion
      In short, we are officially at war with governments around the world!
      MAR 30, 2021, 9:16 AM upvote. downvote. spam. 0Reply

      • b917ff6051ae26fba2ee1de01d30adb088e8dc38. Thomas-Michael
        No!
        We Are officially and Eternally at war/War/WAR with governments around the world!
        You are not alone…
        …STAND:)
        MAR 30, 2021, 7:53 PM upvote. downvote. spam. 0Reply

        • b917ff6051ae26fba2ee1de01d30adb088e8dc38. Thomas-Michael
          No!
          We Are officially and Eternally at war/War/WAR with governments around the world!
          You are not alone…
          …STAND:)
          Alone Again, Or…
          MAR 30, 2021, 8:30 PM upvote. downvote. spam. 0Reply

    • default_avatar. GAN
      Hey Pfizer former VP take your vaccine and shove it up your ass.
      MAR 30, 2021, 11:05 AM upvote. downvote. spam. 0Reply

    • 5d4b364e18d425cfcbddada4a19a07bc21a25331. Ranger007
      Was just writing to my friend about him,then i saw this headlines..Here’s a youtube of him debunking everything SAGA Did…He was careful not to say why they lied,but he’s now coming out with the obvious conclusion..it either they are all so stupid,or they are out to kill us..they know what they are doing..FROM NOVEMBER
      View: https://www.youtube.com/watch?v=8bX-wFVBP94&list=TLPQMjkxMTIwMjBlLeotUeZrxg&index=7&ab_channel=DouglasHowey

      MAR 31, 2021, 12:44 AM upvote. downvote. spam. 0Reply

    • 5d4b364e18d425cfcbddada4a19a07bc21a25331. Ranger007
      I meant SAGE
      MAR 31, 2021, 12:45 AM upvote. downvote. spam. 0Repl
     
  2. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    Former Pfizer chief science officer: The pandemic is over, PCR tests yield false positives

    Former Pfizer VP and Chief Science Officer Mike Yeadon says perceived prevalence of pandemic is based on false positives from PCR tests.

    https://www.israelnationalnews.com/News/News.aspx/292232



    View: https://youtu.be/8bX-wFVBP94


    Mike Yeadon

    - Expert on Viruses Disagrees with Liberal Politicians



    Former Pfizer chief science officer: The pandemic is over, PCR tests yield false positives

    Former Pfizer VP and Chief Science Officer Mike Yeadon says perceived prevalence of pandemic is based on false positives from PCR tests.


    https://www.israelnationalnews.com/News/News.aspx/292232
     
  3. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    themaps.
     
  4. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    thecharts.
     
  5. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    iT iS NEVER GOING TO END ??? WTF

    [​IMG] [​IMG] [​IMG] [​IMG] THE TRUTH IS OUT! [​IMG] [​IMG] [​IMG] [​IMG]

    Pfizer Executive (CFO and VP of supply - Frank A D'Amelio) admits that their vaccine is not designed
    to end the pandemic but to turn it into an 'endemic' so that the demand of their vaccines
    will continue forever and give them the opportunity to make a lot of money selling their vaccine.

    Once the pandemic becomes an endemic,
    like the flu, all those who have already been vaccinated will need to continue to receive a booster every half year or so.

    Thus the Vaccine schedule which will be attached to the vaccination I.D. We must not submit to such tyranny!

    View: http://www.youtube.com/watch?v=WZnlC-eUCoo
     
  6. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
  7. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
  8. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    The COVID-19 RT-PCR Test:

    How to Mislead All Humanity.

    Using a “Test” To Lock Down Society


    It is time for everyone to come out of this negative trance,

    this collective hysteria, because famine, poverty,

    massive unemployment will kill,

    mow down many more people than SARS-CoV-2!



    The COVID-19 RT-PCR Test: How to Mislead All Humanity. Using a "Test" To Lock Down Society - Global ResearchGlobal Research - Centre for Research on Globalization
    https://www.globalresearch.ca/covid...ity-using-a-test-to-lock-down-society/5728483





    By Dr. Pascal Sacré
    Global Research, February 16, 2021
    Global Research 5 November 2020
    Theme: Science and Medicine
    printme.
    5386 1050 641

    8363
    RT-PCR-pr%C3%A9paration-400x267.
    Introduction: using a technique to lock down society
    All current propaganda on the COVID-19 pandemic is based on an assumption that is considered obvious, true and no longer questioned:

    Positive RT-PCR test means being sick with COVID. This assumption is misleading.
    Very few people, including doctors, understand how a PCR test works.
    RT-PCR means Real Time-Polymerase Chain Reaction.
    In French, it means: Réaction de Polymérisation en Chaîne en Temps Réel.
    In medicine, we use this tool mainly to diagnose a viral infection.
    Starting from a clinical situation with the presence or absence of particular symptoms in a patient, we consider different diagnoses based on tests.
    In the case of certain infections, particularly viral infections, we use the RT-PCR technique to confirm a diagnostic hypothesis suggested by a clinical picture.
    We do not routinely perform RT-PCR on any patient who is overheated, coughing or has an inflammatory syndrome!
    It is a laboratory, molecular biology technique of gene amplification because it looks for gene traces (DNA or RNA) by amplifying them.
    In addition to medicine, other fields of application are genetics, research, industry and forensics.
    The technique is carried out in a specialized laboratory, it cannot be done in any laboratory, even a hospital. This entails a certain cost, and a delay sometimes of several days between the sample and the result.
    Today, since the emergence of the new disease called COVID-19 (COrona VIrus Disease-2019), the RT-PCR diagnostic technique is used to define positive cases, confirmed as SARS-CoV-2 (coronavirus responsible for the new acute respiratory distress syndrome called COVID-19).
    These positive cases are assimilated to COVID-19 cases, some of whom are hospitalized or even admitted to intensive care units.
    Official postulate of our managers: positive RT-PCR cases = COVID-19 patients. [1]
    This is the starting postulate, the premise of all official propaganda, which justifies all restrictive government measures: isolation, confinement, quarantine, mandatory masks, color codes by country and travel bans, tracking, social distances in companies, stores and even, even more importantly, in schools [2].
    This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.
    Technical aspects: to better understand and not be manipulated
    The PCR technique was developed by chemist Kary B. Mullis in 1986. Kary Mullis was awarded the Nobel Prize in Chemistry in 1993.
    Although this is disputed [3], Kary Mullis himself is said to have criticized the interest of PCR as a diagnostic tool for an infection, especially a viral one.
    He stated that if PCR was a good tool for research, it was a very bad tool in medicine, in the clinic [4].
    Mullis was referring to the AIDS virus (HIV retrovirus or HIV) [5], before the COVID-19 pandemic, but this opinion on the limitation of the technique in viral infections [6], by its creator, cannot be dismissed out of hand; it must be taken into account!
    PCR was perfected in 1992.
    As the analysis can be performed in real time, continuously, it becomes RT (Real-Time) – PCR, even more efficient.
    It can be done from any molecule, including those of the living, the nucleic acids that make up the genes:
    • DNA (deoxyribonucleic acid)
    • RNA (Ribonucleic Acid)
    Viruses are not considered as “living” beings, they are packets of information (DNA or RNA) forming a genome.
    It is by an amplification technique (multiplication) that the molecule sought is highlighted and this point is very important.
    RT-PCR is an amplification technique [7].

    If there is DNA or RNA of the desired element in a sample, it is not identifiable as such.
    This DNA or RNA must be amplified (multiplied) a certain number of times, sometimes a very large number of times, before it can be detected. From a minute trace, up to billions of copies of a specific sample can be obtained, but this does not mean that there is all that amount in the organism being tested.
    In the case of COVID-19, the element sought by RT-PCR is SARS-CoV-2, an RNA virus [8].
    There are DNA viruses such as Herpes and Varicella viruses.
    The most well known RNA viruses, in addition to coronaviruses, are Influenza, Measles, EBOLA, ZIKA viruses.
    In the case of SARS-CoV-2, RNA virus, an additional specific step is required, a transcription of RNA into DNA by means of an enzyme, Reverse Transcriptase.
    This step precedes the amplification phase.
    It is not the whole virus that is identified, but sequences of its viral genome.
    This does not mean that this gene sequence, a fragment of the virus, is not specific to the virus being sought, but it is an important nuance nonetheless:
    RT-PCR does not reveal any virus, but only parts, specific gene sequences of the virus.
    At the beginning of the year, the SARS-CoV-2 genome was sequenced.
    It consists of about 30,000 base pairs. The nucleic acid (DNA-RNA), the component of the genes, is a sequence of bases. In comparison, the human genome has more than 3 billion base pairs.
    Teams are continuously monitoring the evolution of the SARS-CoV-2 viral genome as it evolves [9-10-11], through the mutations it undergoes. Today, there are many variants [12].
    By taking a few specific genes from the SARS-CoV-2 genome, it is possible to initiate RT-PCR on a sample from the respiratory tract.
    For COVID-19 disease, which has a nasopharyngeal (nose) and oropharyngeal (mouth) entry point, the sample should be taken from the upper respiratory tract as deeply as possible in order to avoid contamination by saliva in particular.
    rt-pcr-tes. A
    ll the people tested said that it is very painful [13].
    The Gold Standard (preferred site for sampling) is the nasopharyngeal (nasal) approach, the most painful route.
    If there is a contraindication to the nasal approach, or preferably to the individual being tested, depending on the official organs, the oropharyngeal approach (through the mouth) is also acceptable. The test may trigger a nausea/vomiting reflex in the individual being tested.
    Normally, for the result of an RT-PCR test to be considered reliable, amplification from 3 different genes (primers) of the virus under investigation is required.
    “The primers are single-stranded DNA sequences specific to the virus. They guarantee the specificity of the amplification reaction. » [14]​
    “The first test developed at La Charité in Berlin by Dr. Victor Corman and his associates in January 2020 allows to highlight the RNA sequences present in 3 genes of the virus called E, RdRp and N. To know if the sequences of these genes are present in the RNA samples collected, it is necessary to amplify the sequences of these 3 genes in order to obtain a signal sufficient for their detection and quantification. »[15].​
    The essential notion of Cycle Time or Cycle Threshold or Ct positivity threshold [16].
    An RT-PCR test is negative (no traces of the desired element) or positive (presence of traces of the desired element).
    However, even if the desired element is present in a minute, negligible quantity, the principle of RT-PCR is to be able to finally highlight it by continuing the amplification cycles as much as necessary.
    RT-PCR can push up to 60 amplification cycles, or even more!
    Here is how it works:
    Cycle 1: target x 2 (2 copies)
    Cycle 2: target x 4 (4 copies)
    Cycle 3: target x 8 (8 copies)
    Cycle 4: target x 16 (16 copies)
    Cycle 5; target x 32 (32 copies)
    Etc exponentially up to 40 to 60 cycles!
    When we say that the Ct (Cycle Time or Cycle Threshold or RT-PCR positivity threshold) is equal to 40, it means that the laboratory has used 40 amplification cycles, i.e. obtained 240 copies.
    This is what underlies the sensitivity of the RT-PCR assay.
    While it is true that in medicine we like to have high specificity and sensitivity of the tests to avoid false positives and false negatives, in the case of COVID-19 disease, this hypersensitivity of the RT-PCR test caused by the number of amplification cycles used has backfired.
    This over-sensitivity of the RT-PCR test is deleterious and misleading!
    It detaches us from the medical reality which must remain based on the real clinical state of the person: is the person ill, does he or she have symptoms?
    That is the most important thing!
    As I said at the beginning of the article, in medicine we always start from the person: we examine him/her, we collect his/her symptoms (complaints-anamnesis) and objective clinical signs (examination) and on the basis of a clinical reflection in which scientific knowledge and experience intervene, we make diagnostic hypotheses.
    Only then do we prescribe the most appropriate tests, based on this clinical reflection.
    We constantly compare the test results with the patient’s clinical condition (symptoms and signs), which takes precedence over everything else when it comes to our decisions and treatments.
    Today, our governments, supported by their scientific safety advice, are making us do the opposite and put the test first, followed by a clinical reflection necessarily influenced by this prior test, whose weaknesses we have just seen, particularly its hypersensitivity.
    None of my clinical colleagues can contradict me.
    Apart from very special cases such as genetic screening for certain categories of populations (age groups, sex) and certain cancers or family genetic diseases, we always work in this direction: from the person (symptoms, signs) to the appropriate tests, never the other way around.
    This is the conclusion of an article in the Swiss Medical Journal (RMS) published in 2007, written by doctors Katia Jaton and Gilbert Greub microbiologists from the University of Lausanne :
    PCR in microbiology: from DNA amplification to result interpretation:
    “To interpret the result of a PCR, it is essential that clinicians and microbiologists share their experiences, so that the analytical and clinical levels of interpretation can be combined.”​
    It would be indefensible to give everyone an electrocardiogram to screen everyone who might have a heart attack one day.
    On the other hand, in certain clinical contexts or on the basis of specific evocative symptoms, there, yes, an electrocardiogram can be beneficial.
    Back to RT-PCR and Ct (Cycle Time or Cycle Threshold).
    In the case of an infectious disease, especially a viral one, the notion of contagiousness is another important element.
    Since some scientific circles consider that an asymptomatic person can transmit the virus, they believe it is important to test for the presence of virus, even if the person is asymptomatic, thus extending the indication of RT-PCR to everyone.
    Are RT-PCR tests good tests for contagiousness? [17]
    This question brings us back to the notion of viral load and therefore Ct.
    The relationship between contagiousness and viral load is disputed by some people [18] and no formal proof, to date, allows us to make a decision.
    However, common sense gives obvious credence to the notion that the more virus a person has inside him or her, especially in the upper airways (oropharynx and nasopharynx), with symptoms such as coughing and sneezing, the higher the risk of contagiousness, proportional to the viral load and the importance of the person’s symptoms.
    This is called common sense, and although modern medicine has benefited greatly from the contribution of science through statistics and Evidence-Based Medicine (EBM), it is still based primarily on common sense, experience and empiricism.
    Medicine is the art of healing.
    No test measures the amount of virus in the sample!
    RT-PCR is qualitative: positive (presence of the virus) or negative (absence of the virus).
    This notion of quantity, therefore of viral load, can be estimated indirectly by the number of amplification cycles (Ct) used to highlight the virus sought.
    The lower the Ct used to detect the virus fragment, the higher the viral load is considered to be (high).
    The higher the Ct used to detect the virus fragment, the lower the viral load is considered to be (low).
    Thus, the French National Reference Centre (CNR), in the acute phase of the pandemic, estimated that the peak of viral shedding occurred at the onset of symptoms, with an amount of virus corresponding to approximately 108 (100 million) copies of SARS-CoV-2 viral RNA on average (French COVID-19 cohort data) with a variable duration of shedding in the upper airways (from 5 days to more than 5 weeks) [19].
    This number of 108 (100 million) copies/μl corresponds to a very low Ct.
    A Ct of 32 corresponds to 10-15 copies/μl.
    A Ct of 35 corresponds to about 1 copy/μl.
    Above Ct 35, it becomes impossible to isolate a complete virus sequence and culture it!
    In France and in most countries, Ct levels above 35, even 40, are still used even today!
    The French Society of Microbiology (SFM) issued an opinion on September 25, 2020 in which it does not recommend quantitative results, and it recommends to make positive up to a Ct of 37 for a single gene [20]!
    With 1 copy/μl of a sample (Ct 35), without cough, without symptoms, one can understand why all these doctors and scientists say that a positive RT-PCR test means nothing, nothing at all in terms of medicine and clinic!
    Positive RT-PCR tests, without any mention of Ct or its relation to the presence or absence of symptoms, are used as is by our governments as the exclusive argument to apply and justify their policy of severity, austerity, isolation and aggression of our freedoms, with the impossibility to travel, to meet, to live normally!
    There is no medical justification for these decisions, for these governmental choices!
    In an article published on the website of the New York Times (NYT) on Saturday, August 29, American experts from Harvard University are surprised that RT-PCR tests as practiced can serve as tests of contagiousness, even more so as evidence of pandemic progression in the case of SARS-CoV-2 infection [21].
    I’m a Clinical Lab Scientist, COVID-19 Is Fake, Wake Up America!
    According to them, the threshold (Ct) considered results in positive diagnoses in people who do not represent any risk of transmitting the virus!
    The binary “yes/no” answer is not enough, according to this epidemiologist from the Harvard University School of Public Health.
    “It’s the amount of virus that should dictate the course of action for each patient tested. »​
    The amount of virus (viral load); but also and above all the clinical state, symptomatic or not of the person!
    This calls into question the use of the binary result of this RT-PCR test to determine whether a person is contagious and must follow strict isolation measures.
    These questions are being raised by many physicians around the world, not only in the United States but also in France, Belgium (Belgium Health Experts Demand Investigation Of WHO For Faking Coronavirus Pandemic), France, Germany, Italy, the United Kingdom, the United States and the United Kingdom. in Germany, Spain…
    According to them: “We are going to put tens of thousands of people in confinement, in isolation, for nothing. » [22]. 22] And inflict suffering, anguish, economic and psychological dramas by the thousands!
    Most RT-PCR tests set the Ct at 40, according to the NYT. Some set it at 37.
    “Tests with such high thresholds (Ct) may not only detect live virus but also gene fragments, remnants of an old infection that do not represent any particular danger,” the experts said.
    A virologist at the University of California admits that an RT-PCR test with a Ct greater than 35 is too sensitive. “A more reasonable threshold would be between 30 and 35,” she adds.
    Almost no laboratory specifies the Ct (number of amplification cycles performed) or the number of copies of viral RNA per sample μl.
    Here is an example of a laboratory result (approved by Sciensano, the Belgian national reference center) in an RT-PCR negative patient:
    Capture-d%E2%80%99%C3%A9cran-le-2020-10-14-%C3%A0-15.57.40-1024x390.
    No mention of Ct.
    In the NYT, experts compiled three datasets with officials from the states of Massachusetts, New York and Nevada that mention them.
    Conclusion?
    “Up to 90% of the people who tested positive did not carry a virus. »
    The Wadworth Center, a New York State laboratory, analyzed the results of its July tests at the request of the NYT: 794 positive tests with a Ct of 40.
    “With a Ct threshold of 35, approximately half of these PCR tests would no longer be considered positive,” said the NYT.
    “And about 70% would no longer be considered positive with a Ct of 30! “
    In Massachusetts, between 85 and 90% of people who tested positive in July with a Ct of 40 would have been considered negative with a Ct of 30, adds the NYT. And yet, all these people had to isolate themselves, with all the dramatic psychological and economic consequences, while they were not sick and probably not contagious at all.
    In France, the Centre National de Référence (CNR), the French Society of Microbiology (SFM) continue to push Ct to 37 and recommend to laboratories to use only one gene of the virus as a primer.
    I remind you that from Ct 32 onwards, it becomes very difficult to culture the virus or to extract a complete sequence, which shows the completely artificial nature of this positivity of the test, with such high Ct levels, above 30.
    Similar results were reported by researchers from the UK Public Health Agency in an article published on August 13 in Eurosurveillance: “The probability of culturing the virus drops to 8% in samples with Ct levels above 35.” [23]
    In addition, currently, the National Reference Center in France only evaluates the sensitivity of commercially available reagent kits, not their specificity: serious doubts persist about the possibility of cross-reactivity with viruses other than SARS-CoV-2, such as other benign cold coronaviruses. [20]
    It is potentially the same situation in other countries, including Belgium.
    Similarly, mutations in the virus may have invalidated certain primers (genes) used to detect SARS-CoV-2: the manufacturers give no guarantees on this, and if the AFP fast-checking journalists tell you otherwise, test their good faith by asking for these guarantees, these proofs.
    If they have nothing to hide and if what I say is false, this guarantee will be provided to you and will prove their good faith.
    1. We must demand that the RT-PCR results be returned mentioning the Ct used because beyond Ct 30, a positive RT-PCR test means nothing.
    2. We must listen to the scientists and doctors, specialists, virologists who recommend the use of adapted Ct, lower, at 30. An alternative is to obtain the number of copies of viral RNA/μl or /ml sample. [23]
    3. We need to go back to the patient, to the person, to his or her clinical condition (presence or absence of symptoms) and from there to judge the appropriateness of testing and the best way to interpret the result.
    Until there is a better rationale for PCR screening, with a known and appropriate Ct threshold, an asymptomatic person should not be tested in any way.
    Even a symptomatic person should not automatically be tested, as long as they can place themselves in isolation for 7 days.
    Let’s stop this debauchery of RT-PCR testing at too high Ct levels and return to clinical, quality medicine.
    Once we understand how RT-PCR testing works, it becomes impossible to let the current government routine screening strategy, inexplicably supported by the virologists in the safety councils, continue.
    My hope is that, finally, properly informed, more and more people will demand that this strategy be stopped, because it is all of us, enlightened, guided by real benevolence and common sense, who must decide our collective and individual destinies.
    No one else should do it for us, especially when we realize that those who decide are no longer reasonable or rational.
    Summary of important points :
    • The RT-PCR test is a laboratory diagnostic technique that is not well suited to clinical medicine.
    • It is a binary, qualitative diagnostic technique that confirms (positive test) or not (negative test) the presence of an element in the medium being analyzed. In the case of SARS-CoV-2, the element is a fragment of the viral genome, not the virus itself.
    • In medicine, even in an epidemic or pandemic situation, it is dangerous to place tests, examinations, techniques above clinical evaluation (symptoms, signs). It is the opposite that guarantees quality medicine.
    • The main limitation (weakness) of the RT-PCR test, in the current pandemic situation, is its extreme sensitivity (false positive) if a suitable threshold of positivity (Ct) is not chosen. Today, experts recommend using a maximum Ct threshold of 30.
    • This Ct threshold must be informed with the positive RT-PCR result so that the physician knows how to interpret this positive result, especially in an asymptomatic person, in order to avoid unnecessary isolation, quarantine, psychological trauma.
    • In addition to mentioning the Ct used, laboratories must continue to ensure the specificity of their detection kits for SARS-CoV-2, taking into account its most recent mutations, and must continue to use three genes from the viral genome being studied as primers or, if not, mention it.

    Overall Conclusion
    Is the obstinacy of governments to use the current disastrous strategy, systematic screening by RT-PCR, due to ignorance?
    Is it due to stupidity?
    To a kind of cognitive trap trapping their ego?
    In any case, we should be able to question them, and if among the readers of this article there are still honest journalists, or naive politicians, or people who have the possibility to question our rulers, then do so, using these clear and scientific arguments.
    It is all the more incomprehensible that our rulers have surrounded themselves with some of the most experienced specialists in these matters.
    If I have been able to gather this information myself, shared, I remind you, by competent people above all suspicion of conspiracy, such as Hélène Banoun, Pierre Sonigo, Jean-François Toussaint, Christophe De Brouwer, whose intelligence, intellectual honesty and legitimacy cannot be questioned, then the Belgian, French and Quebec scientific advisors, etc., know all this as well.
    So?
    What’s going on?
    Why continue in this distorted direction, obstinately making mistakes?
    It is not insignificant to reimpose confinements, curfews, quarantines, reduced social bubbles, to shake up again our shaky economies, to plunge entire families into precariousness, to sow so much fear and anxiety generating a real state of post-traumatic stress worldwide, to reduce access to care for other pathologies that nevertheless reduce life expectancy much more than COVID-19! [24]
    Is there intent to harm?
    Is there an intention to use the alibi of a pandemic to move humanity towards an outcome it would otherwise never have accepted? In any case, not like that!
    Would this hypothesis, which modern censors will hasten to label “conspiracy”, be the most valid explanation for all this?

    Indeed, if we draw a straight line from the present events, if they are maintained, we could find ourselves once again confined with hundreds, thousands of human beings forced to remain inactive, which, for the professions of catering, entertainment, sales, fairgrounds, itinerants, canvassers, risks being catastrophic with bankruptcies, unemployment, depression, suicides by the hundreds of thousands. [25-26-27-28]
    The impact on education, on our children, on teaching, on medicine with long planned care, operations, treatments to be cancelled, postponed, will be profound and destructive.
    “We risk a looming food crisis if action is not taken quickly.” [29].
    It is time for everyone to come out of this negative trance, this collective hysteria, because famine, poverty, massive unemployment will kill, mow down many more people than SARS-CoV-2!
    Does all this make sense in the face of a disease that is declining, over-diagnosed and misinterpreted by this misuse of overly sensitively calibrated PCR tests?
    For many, the continuous wearing of the mask seems to have become a new norm.
    Even if it is constantly downplayed by some health professionals and fact-checking journalists, other doctors warn of the harmful consequences, both medical and psychological, of this hygienic obsession which, maintained permanently, is in fact an abnormality!
    What a hindrance to social relations, which are the true foundation of a physically and psychologically healthy humanity!
    Some dare to find all this normal, or a lesser price to pay in the face of the pandemic of positive PCR tests.
    Isolation, distancing, masking of the face, impoverishment of emotional communication, fear of touching and kissing even within families, communities, between relatives…
    Spontaneous gestures of daily life hindered and replaced by mechanical and controlled gestures …
    Terrified children, kept in permanent fear and guilt…
    All this will have a deep, lasting and negative impact on human organisms, in their physical, mental, emotional and representation of the world and society.
    This is not normal!
    We cannot let our rulers, for whatever reason, organize our collective suicide any longer.
    Translated from French by Global Research. Original source: Mondialisation.ca
    Dr Pascal Sacré is a physician specialized in critical care, author and renowned public health analyst, Charleroi, Belgium. He is a Research Associate of the entre for Research on Globalization (CRG)

    ****
    Professionals whose references and comments are the basis of this article in its scientific aspect (especially and mainly on RT-PCR):
    1) Hélène Banoun

    https://www.researchgate.net/profile/Helene_Banoun
    PhD, Pharmacist biologist
    Former INSERM Research Officer
    Former intern at the Paris Hospitals
    2) Pierre Sonigo
    Virologist
    Research Director INSERM, worked at the Pasteur Institute
    Heads the Virus Genetics Laboratory in Cochin, Paris.
    Participated in 1985 in the sequencing of the AIDS virus.
    3) Christophe De Brouwer
    PhD in Public Health Science
    Honorary Professor at the School of Public Health at ULB, Belgium
    4) Jean-François Toussaint
    Doctor, Professor of Physiology at the University of Paris-Descartes
    Director of IRMES, Institute for BioMedical Research and Sports Epidemiology
    Former member of the High Council of Public Health
    ***
    Notes (French)
    [1] “Une nette augmentation du nombre de cas dans toutes les provinces et toutes les tranches d’âge”, 7sur7 ACTU Belgique, 5-10-2020
    [2] Le gouvernement belge renforce des mesures anti-Covid, VRT.be ; 6 octobre 2020.
    [3] Non, l’inventeur du test PCR n’a pas dit que sa méthode était inefficace pour détecter les virus, dans Le Monde, 7 octobre 2020
    [4] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.
    [5] https://www.weblyf.com/2020/05/coro...test-kit-from-the-inventor-and-other-experts/
    [6] « The Truth about PCR Test Kit from the Inventor and Other Experts »
    [7] PCR en microbiologie : de l’amplification de l’ADN à l’interprétation du résultat
    [8] COVID : La PCR nasale peut-elle mentir ?, Dr Pascal Sacré, AIMSIB, 30 août 2020.
    [9]
    View: https://www.youtube.com/watch?v=CaAcSJI0oMs&feature=youtu.be
    , 8 octobre 2020. Évolution génomique des virus ARN à l’Institut Pasteur, environ la moitié des nucléotides sont susceptibles d’avoir muté sur les 30 000 nucléotides de l’ARN viral. « Pour l’instant aucune mutation ou délétion n’a été associée à une perte de sévérité de la maladie sur une grande échelle géographique mais de nombreuses publications devraient bientôt préciser ces points. »
    [10] https://www.mediterranee-infection....0/04/FD_Raoult_SARS-CoV-2_EID_Sep2020_vL2.pdf, Article IHU-Méditerranée, Professeur D. Raoult, Dramatic increase in the SARS-CoV-2 mutation rate and low mortality rate during the second epidemic in summer in Marseille, 7 septembre 2020
    Conclusions :
    Dans l’ensemble, comme l’ont récemment souligné Tomaszewski et al. (7) qui ont décrit pour les génomes viraux disponibles jusqu’en mai 2020 un déplacement mutationnel sur la spike et le complexe de réplication vers des gènes codant pour d’autres protéines non structurelles qui interagissent avec les voies de défense de l’hôte, il semble que le taux de mutation du SARS-CoV-2 s’accélère depuis mai, impliquant principalement des mutations C vers U. L’augmentation du taux de mutation du SRAS-CoV-2 génère des génotypes viraux plus éloignés de la souche Wuhan initiale que ceux observés de mars à avril. Cela semble entraîner des épidémies de durée limitée, du moins pour le premier nouveau génotype que nous avons identifié, et est associé à une gravité globalement moindre à ce stade du développement de cette nouvelle épidémie.
    Mutations observed in these seven different viral genotypes are located in most SARS- CoV-2 genes including structural and non-structural genes among which nsp2, nsp3 (predicted phosphoesterase), nsp5 (membrane glycoprotein), nsp12 (RNA-dependent RNA polymerase), S (Spike glycoprotein), ORF3a, E (membrane glycoprotein), M (membrane glycoprotein), ORF8 and N (Nucleocapsid phosphoprotein).
    [11] https://www.researchgate.net/profile/Helene_Banoun Evolution of SARS-CoV-2: Review of mutations, role of the host immune system, octobre 2020, mise à jour par Hélène Banoun,
    PhD, Pharmacien biologiste, ancien Chargé de Recherches INSERM, ancien Interne des Hôpitaux de Paris.
    [12] https://nextstrain.org/, We are incorporating SARS-CoV-2 genomes as soon as they are shared and providing analyses and situation reports. In addition we have developed a number of resources and tools, and are facilitating independent groups to run their own analysis. Please see the main SARS-CoV-2 page for more.
    [13] Tutoriel prélèvement nasopharyngé : Un geste technique, essentiel à la fiabilité du test COVID-19
    [14] Covid-19 : comment fonctionnent les tests et quelles sont leurs utilités ?
    [15] COMMENT FONCTIONNENT LES TESTS DE DÉPISTAGE DU COVID-19 ? 7 avril 2020, Laboratoire de biologie et pharmacologie appliquée (LBPA), Clémence Richetta, maître de conférences au département biologie de l’ENS Paris-Saclay et chercheuse en virologie au LBPA :
    View: https://www.youtube.com/watch?v=hNVDHCf8bGA

    Independent researcher, PhD 9
    Former research fellow at INSERM (French Institute for Health and Medical Research)
    [16] Par Pierre Sonigo, virologiste (un des découvreurs du VIH), MD PhD, CSO at Sebia, clinical diagnostics
    https://www.linkedin.com/pulse/diagnostic-du-covid19-comprendre-les-tests-pcr-leur-et-pierre-sonigo/?trackingId=pTYxDkpvRzKHWZwCzxSIag%3D%3D
    Diagnostic du COVID19 : comprendre les tests PCR, leur interprétation et leurs limites, publié le 16 septembre 2020
    La PCR utilise un principe très particulier : la cible du test, un fragment d’ARN viral, est massivement amplifiée afin de permettre sa détection. Au cours de l’analyse, une réaction enzymatique associée à des « cycles » de variation de température permet une série de « réplications » successives de l’acide nucléique cible. Chaque cycle correspond à une multiplication théorique de la cible par 2. On multiplie donc par 2 en un cycle, par 4 en 2 cycles, par 8 en 3 cycles, par 16 en 4 cycles, et ainsi de suite de manière exponentielle. A l’heure actuelle, l’amplification est généralement pratiquée sur 40 cycles, soit une amplification théorique de 2^40, environ mille milliards de fois ! En réalité, la réplication n’est pas efficace à 100%, mais la cible est amplifiée environ un million de fois, ce qui permet de détecter moins d’une dizaine de fragments d’ARN dans le volume analysé.
    Lorsque l’acide nucléique viral est détectable après un petit nombre de cycles, cela signifie que la quantité de virus dans l’échantillon de départ est grande. Au contraire, lorsqu’il faut un grand nombre de cycles de réplication pour détecter l’ARN viral, cela signifie que l’échantillon de départ contient une quantité de virus très faible. On parle alors en nombre de cycles, ou Ct, qui signifie « cycle time », pour définir, au moins de façon semi quantitative, la quantité d’ARN présent dans l’échantillon de départ. Ainsi, un petit Ct correspond à un grand nombre de copies, un grand Ct à un petit nombre de copies.
    Cette spectaculaire sensibilité n’est pas sans inconvénient et nécessite des précautions particulières. En effet, un échantillon positif amplifié un million de fois contient une très haute concentration de cible et le risque qu’il contamine (carry over) d’autres échantillons est particulièrement élevé. La saturation des laboratoires peut encore accroître ce risque et générer des faux positifs accidentels. Dans ces conditions, il est important que les résultats positifs soient confirmés par un second test, à plus forte raison lorsqu’un test positif présente des conséquences significatives, qu’elles soient médicales, professionnelles ou liées à l’obligation d’isolement.
    La deuxième question importante concernant la PCR, une fois encore conséquence de sa spectaculaire sensibilité, est celle de sa signification clinique. Un sujet parfaitement asymptomatique présentant une PCR positive ne peut être qualifié de « malade », comme on le lit dans les médias qui rapportent la progression de l’épidémie ! Peut-on même parler de « cas » ? C’est pourtant le terme utilisé dans les dénombrements officiels. Ne sommes-nous pas en train d’oublier le patient pour se focaliser sur la technologie ? Est-ce une épidémie d’ARN dans des tubes que nous surveillons ou une maladie grave et potentiellement mortelle ?
    Des publications récentes soulignent que la dose détectable par PCR est inférieure à la dose infectieuse ou contagieuse : aucun virus infectieux n’a pu être retrouvé chez les patients asymptomatiques présentant des tests PCR positifs avec un Ct élevé. Suite à ces résultats, la question du seuil de Ct qui permet de déclarer un échantillon positif est débattue. Peut-on rendre un résultat négatif chez un sujet asymptomatique dont la positivité apparaît au-delà de 35 cycles ? A défaut, est-il utile de retester ces échantillons ? Comme souvent en matière de diagnostic médical, lorsqu’un seuil de positivité est déterminé, faut-il privilégier la sensibilité ou la spécificité du test ?
    De plus, un échantillon confirmé positif d’un point de vue analytique reste un faux positif du point de vue de la clinique, si la personne testée est en parfaite santé, parfois même prêt à affronter une compétition de tennis ou de football professionnels ! La question devient uniquement celle de sa potentielle contagiosité. C’est la question de la transmission éventuelle par des sujets asymptomatiques, qui sans être eux-mêmes en danger, pourraient en représenter un pour les autres.
    Par rapport à cette question, il est important de raisonner quantitativement. La virologie, ce n’est pas du tout ou rien. De manière générale, au cours des infections virales aiguës, le risque de contagion et la gravité de l’infection varient en fonction de la quantité de virus présents dans l’organisme et de leur excrétion dans le milieu extérieur. Quelques copies de virus tapis dans les sinus n’ont pas la dangerosité d’un million projetés par la toux. Un sujet asymptomatique produit moins de virus qu’un sujet symptomatique et les sécrète moins vers l’extérieur. La quantité de virus produite et donc le risque de contagion sont corrélés à la gravité des symptômes. Même si elle n’est pas de zéro, le risque de transmission est donc vraisemblablement faible pour un sujet asymptomatique. Malheureusement, répéter sans cesse que la contagion venant d’un sujet parfaitement asymptomatique est possible sans aucune précision sur le niveau de risque pousse à prendre des mesures disproportionnées avec le risque.
    De même, la stratégie « dépister-isoler » n’est pas réaliste lorsque le dépistage n’est pas suffisamment fiable et surtout lorsque le virus est déjà largement répandu dans la population. Il est bien trop tard pour appliquer une méthode conçue pour bloquer une épidémie à sa naissance. Comme pour une invasion de coccinelles ou de frelons, on ne peut stopper un virus qui est déjà partout avec une passoire trouée à 25% et bouchée par endroits. L’échec de la stratégie actuelle est plutôt lié à sa conception naïve et inapplicable qu’aux mauvais comportements des citoyens.
    Si, comme on l’observe en ce moment, la diffusion virale reprend, faut-il dépister plus massivement ou revoir la stratégie de protection de la population ?
    Cette question ne relève pas de la science. Elle dépend des risques acceptables par un individu ou par un groupe. Si on est dans la recherche du risque minimal, proche de zéro, parce que le risque n’a pas été quantifié, ou pour des raisons de responsabilité juridique, on doit prendre les précautions maximales. Si on accepte un risque même faible, on peut reprendre certaines libertés et protéger ceux qui en ont réellement besoin.
    Le scientifique doit mesurer la grandeur des risques et ne pas se contenter d’affirmer qu’un événement adverse est « possible ». Mais ce n’est pas son rôle de décider si ces risques peuvent être pris par autrui.
    Les tests PCR permettent une détection extrêmement sensible de l’ARN viral. Ils sont indispensables mais ne sont pas la solution ultime et unique qui permettra de contrôler l’épidémie et de gérer efficacement les risques de contagion. Appliquée lorsque le virus est largement disséminé dans la population, la stratégie « dépister isoler » est vouée à l’échec. Du fait de la sensibilité très élevée et des limites de leur spécificité, les tests PCR doivent être pratiqués et interprétés avec précaution, et comme toujours en lien avec le contexte clinique et épidémiologique. N’oublions pas qu’un sujet asymptomatique doit plutôt être considéré comme immunisé que comme malade.
    [17] Les tests RT-PCR du Covid-19 se révèlent être de très mauvais tests de contagiosité, Xavier Boisinet, mis à jour le 3/9/2020.
    [18] De nombreuses publications partagées des milliers de fois sur les réseaux sociaux en quelques jours affirment que « 90% » des personnes déclarées positives au Covid-19 ont en fait des charges virales trop basses pour être « malades » ou « contagieuses ». C’est faux.
    [19] Mise au point du CNR sur la réalisation des prélèvements et la sensibilité des tests RT-PCR pour la détection du SARS-CoV-2, 9 mai 2020
    [20] Avis du 25 septembre 2020 de la Société Française de Microbiologie (SFM) relatif à l’interprétation de la valeur de Ct (estimation de la charge virale) obtenue en cas de RT-PCR SARS-CoV-2 positive sur les prélèvements cliniques réalisés à des fins diagnostiques ou de dépistage, 25 septembre 2020
    [21] Coronavirus – Les tests PCR inadaptés contre l’épidémie? « Jusqu’à 90% de personnes testées ne seraient pas contagieuses », basé sur une étude d’une équipe de Harvard ( Harvard TH Chan School of Public Health) de Michael Mina, département d’épidémiologie, je vous mets en fichier joint le PDF correspondant, une étude, reprise par le NY Times :
    « Pour eux, la limite du test PCR (prélèvement par voie nasale ou salivaire) réside dans la brutalité et la simplicité du résultat qu’il donne. La personne est soit positive, soit négative. Pas plus de renseignement, notamment sur la contagiosité du malade.
    Or, les scientifiques d’Harvard soulèvent le problème de la quantité de virus que ce test PCR ne donne pas et qui pourrait, selon eux, permettre de donner des clés supplémentaires pour contrer l’épidémie.
    « Les tests standards diagnostiquent un grand nombre de personnes qui peuvent être porteuses de quantités relativement insignifiantes du virus », explique ainsi le Dr. Michael Mina, épidémiologiste à la Harvard TH Chan School of Public Health
    . »
    [22] « Au rythme actuel avec nos tests RT-PCR, nous allons confiner des dizaines de milliers de gens pour rien », alerte le Dr. Yvon Le Flohic, manuel Moragues, 3 septembre 2020.
    [23] Tests de diagnostic ultra sensibles, les tests RT-PCR sortent positifs même pour des individus qui portent trop peu de virus pour être encore contagieux. Pour en faire de meilleurs tests de contagiosité, certains appellent à baisser leur seuil de détection. Est-ce une bonne idée ? Quelles sont les limites de cette solution ? Décryptage.Xavier Boinivet, 15 septembre 2020
    [24] Jean-Luc Gala (UCL) estime que les futures mesures de la Celeval, tel le lockdown, vont tuer l’économie, provoquer des suicides et déstabiliser l’État. Le Celeval, ou Cellule d’évaluation, est le groupe d’experts qui conseillent le gouvernement belge dans la gestion du COVID.
    [25] L’OMS plaide pour éviter à tout prix les confinements : ‘Cela ne rend que les pauvres plus pauvres’
    [26] Voici comment la pandémie risque de faire exploser la pauvreté mondiale, une première en 22 ans
    [27] ‘Le coronavirus menace 500 millions de personnes de pauvreté’, prévient l’Oxfam. Ce n’est pas le coronavirus, la menace, mais l’attitude de nos gouvernants face au coronavirus !
    [28] Le chômage de masse est désormais mondial
    [29] ‘Nous risquons une crise alimentaire imminente si des mesures ne sont pas prises rapidement’. Encore une fois, ce n’est pas à cause du coronavirus, mais à cause de notre attitude face à cette crise.
    By Dr. Pascal Sacré
    Global Research, February 16, 2021
    Global Research 5 November 2020
    Theme: Science and Medicine
    printme.
    5386 1050 641

    8363
    RT-PCR-pr%C3%A9paration-400x267.
    Introduction: using a technique to lock down society
    All current propaganda on the COVID-19 pandemic is based on an assumption that is considered obvious, true and no longer questioned:

    Positive RT-PCR test means being sick with COVID. This assumption is misleading.
    Very few people, including doctors, understand how a PCR test works.
    RT-PCR means Real Time-Polymerase Chain Reaction.
    In French, it means: Réaction de Polymérisation en Chaîne en Temps Réel.
    In medicine, we use this tool mainly to diagnose a viral infection.
    Starting from a clinical situation with the presence or absence of particular symptoms in a patient, we consider different diagnoses based on tests.
    In the case of certain infections, particularly viral infections, we use the RT-PCR technique to confirm a diagnostic hypothesis suggested by a clinical picture.
    We do not routinely perform RT-PCR on any patient who is overheated, coughing or has an inflammatory syndrome!
    It is a laboratory, molecular biology technique of gene amplification because it looks for gene traces (DNA or RNA) by amplifying them.
    In addition to medicine, other fields of application are genetics, research, industry and forensics.
    The technique is carried out in a specialized laboratory, it cannot be done in any laboratory, even a hospital. This entails a certain cost, and a delay sometimes of several days between the sample and the result.
    Today, since the emergence of the new disease called COVID-19 (COrona VIrus Disease-2019), the RT-PCR diagnostic technique is used to define positive cases, confirmed as SARS-CoV-2 (coronavirus responsible for the new acute respiratory distress syndrome called COVID-19).
    These positive cases are assimilated to COVID-19 cases, some of whom are hospitalized or even admitted to intensive care units.
    Official postulate of our managers: positive RT-PCR cases = COVID-19 patients. [1]
    This is the starting postulate, the premise of all official propaganda, which justifies all restrictive government measures: isolation, confinement, quarantine, mandatory masks, color codes by country and travel bans, tracking, social distances in companies, stores and even, even more importantly, in schools [2].
    This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.
    Technical aspects: to better understand and not be manipulated
    The PCR technique was developed by chemist Kary B. Mullis in 1986. Kary Mullis was awarded the Nobel Prize in Chemistry in 1993.
    Although this is disputed [3], Kary Mullis himself is said to have criticized the interest of PCR as a diagnostic tool for an infection, especially a viral one.
    He stated that if PCR was a good tool for research, it was a very bad tool in medicine, in the clinic [4].
    Mullis was referring to the AIDS virus (HIV retrovirus or HIV) [5], before the COVID-19 pandemic, but this opinion on the limitation of the technique in viral infections [6], by its creator, cannot be dismissed out of hand; it must be taken into account!
    PCR was perfected in 1992.
    As the analysis can be performed in real time, continuously, it becomes RT (Real-Time) – PCR, even more efficient.
    It can be done from any molecule, including those of the living, the nucleic acids that make up the genes:
    • DNA (deoxyribonucleic acid)
    • RNA (Ribonucleic Acid)
    Viruses are not considered as “living” beings, they are packets of information (DNA or RNA) forming a genome.
    It is by an amplification technique (multiplication) that the molecule sought is highlighted and this point is very important.
    RT-PCR is an amplification technique [7].

    If there is DNA or RNA of the desired element in a sample, it is not identifiable as such.
    This DNA or RNA must be amplified (multiplied) a certain number of times, sometimes a very large number of times, before it can be detected. From a minute trace, up to billions of copies of a specific sample can be obtained, but this does not mean that there is all that amount in the organism being tested.
    In the case of COVID-19, the element sought by RT-PCR is SARS-CoV-2, an RNA virus [8].
    There are DNA viruses such as Herpes and Varicella viruses.
    The most well known RNA viruses, in addition to coronaviruses, are Influenza, Measles, EBOLA, ZIKA viruses.
    In the case of SARS-CoV-2, RNA virus, an additional specific step is required, a transcription of RNA into DNA by means of an enzyme, Reverse Transcriptase.
    This step precedes the amplification phase.
    It is not the whole virus that is identified, but sequences of its viral genome.
    This does not mean that this gene sequence, a fragment of the virus, is not specific to the virus being sought, but it is an important nuance nonetheless:
    RT-PCR does not reveal any virus, but only parts, specific gene sequences of the virus.
    At the beginning of the year, the SARS-CoV-2 genome was sequenced.
    It consists of about 30,000 base pairs. The nucleic acid (DNA-RNA), the component of the genes, is a sequence of bases. In comparison, the human genome has more than 3 billion base pairs.
    Teams are continuously monitoring the evolution of the SARS-CoV-2 viral genome as it evolves [9-10-11], through the mutations it undergoes. Today, there are many variants [12].
    By taking a few specific genes from the SARS-CoV-2 genome, it is possible to initiate RT-PCR on a sample from the respiratory tract.
    For COVID-19 disease, which has a nasopharyngeal (nose) and oropharyngeal (mouth) entry point, the sample should be taken from the upper respiratory tract as deeply as possible in order to avoid contamination by saliva in particular.
    rt-pcr-tes. A
    ll the people tested said that it is very painful [13].
    The Gold Standard (preferred site for sampling) is the nasopharyngeal (nasal) approach, the most painful route.
    If there is a contraindication to the nasal approach, or preferably to the individual being tested, depending on the official organs, the oropharyngeal approach (through the mouth) is also acceptable. The test may trigger a nausea/vomiting reflex in the individual being tested.
    Normally, for the result of an RT-PCR test to be considered reliable, amplification from 3 different genes (primers) of the virus under investigation is required.
    “The primers are single-stranded DNA sequences specific to the virus. They guarantee the specificity of the amplification reaction. » [14]​
    “The first test developed at La Charité in Berlin by Dr. Victor Corman and his associates in January 2020 allows to highlight the RNA sequences present in 3 genes of the virus called E, RdRp and N. To know if the sequences of these genes are present in the RNA samples collected, it is necessary to amplify the sequences of these 3 genes in order to obtain a signal sufficient for their detection and quantification. »[15].​
    The essential notion of Cycle Time or Cycle Threshold or Ct positivity threshold [16].
    An RT-PCR test is negative (no traces of the desired element) or positive (presence of traces of the desired element).
    However, even if the desired element is present in a minute, negligible quantity, the principle of RT-PCR is to be able to finally highlight it by continuing the amplification cycles as much as necessary.
    RT-PCR can push up to 60 amplification cycles, or even more!
    Here is how it works:
    Cycle 1: target x 2 (2 copies)
    Cycle 2: target x 4 (4 copies)
    Cycle 3: target x 8 (8 copies)
    Cycle 4: target x 16 (16 copies)
    Cycle 5; target x 32 (32 copies)
    Etc exponentially up to 40 to 60 cycles!
    When we say that the Ct (Cycle Time or Cycle Threshold or RT-PCR positivity threshold) is equal to 40, it means that the laboratory has used 40 amplification cycles, i.e. obtained 240 copies.
    This is what underlies the sensitivity of the RT-PCR assay.
    While it is true that in medicine we like to have high specificity and sensitivity of the tests to avoid false positives and false negatives, in the case of COVID-19 disease, this hypersensitivity of the RT-PCR test caused by the number of amplification cycles used has backfired.
    This over-sensitivity of the RT-PCR test is deleterious and misleading!
    It detaches us from the medical reality which must remain based on the real clinical state of the person: is the person ill, does he or she have symptoms?
    That is the most important thing!
    As I said at the beginning of the article, in medicine we always start from the person: we examine him/her, we collect his/her symptoms (complaints-anamnesis) and objective clinical signs (examination) and on the basis of a clinical reflection in which scientific knowledge and experience intervene, we make diagnostic hypotheses.
    Only then do we prescribe the most appropriate tests, based on this clinical reflection.
    We constantly compare the test results with the patient’s clinical condition (symptoms and signs), which takes precedence over everything else when it comes to our decisions and treatments.
    Today, our governments, supported by their scientific safety advice, are making us do the opposite and put the test first, followed by a clinical reflection necessarily influenced by this prior test, whose weaknesses we have just seen, particularly its hypersensitivity.
    None of my clinical colleagues can contradict me.
    Apart from very special cases such as genetic screening for certain categories of populations (age groups, sex) and certain cancers or family genetic diseases, we always work in this direction: from the person (symptoms, signs) to the appropriate tests, never the other way around.
    This is the conclusion of an article in the Swiss Medical Journal (RMS) published in 2007, written by doctors Katia Jaton and Gilbert Greub microbiologists from the University of Lausanne :
    PCR in microbiology: from DNA amplification to result interpretation:
    “To interpret the result of a PCR, it is essential that clinicians and microbiologists share their experiences, so that the analytical and clinical levels of interpretation can be combined.”​
    It would be indefensible to give everyone an electrocardiogram to screen everyone who might have a heart attack one day.
    On the other hand, in certain clinical contexts or on the basis of specific evocative symptoms, there, yes, an electrocardiogram can be beneficial.
    Back to RT-PCR and Ct (Cycle Time or Cycle Threshold).
    In the case of an infectious disease, especially a viral one, the notion of contagiousness is another important element.
    Since some scientific circles consider that an asymptomatic person can transmit the virus, they believe it is important to test for the presence of virus, even if the person is asymptomatic, thus extending the indication of RT-PCR to everyone.
    Are RT-PCR tests good tests for contagiousness? [17]
    This question brings us back to the notion of viral load and therefore Ct.
    The relationship between contagiousness and viral load is disputed by some people [18] and no formal proof, to date, allows us to make a decision.
    However, common sense gives obvious credence to the notion that the more virus a person has inside him or her, especially in the upper airways (oropharynx and nasopharynx), with symptoms such as coughing and sneezing, the higher the risk of contagiousness, proportional to the viral load and the importance of the person’s symptoms.
    This is called common sense, and although modern medicine has benefited greatly from the contribution of science through statistics and Evidence-Based Medicine (EBM), it is still based primarily on common sense, experience and empiricism.
    Medicine is the art of healing.
    No test measures the amount of virus in the sample!
    RT-PCR is qualitative: positive (presence of the virus) or negative (absence of the virus).
    This notion of quantity, therefore of viral load, can be estimated indirectly by the number of amplification cycles (Ct) used to highlight the virus sought.
    The lower the Ct used to detect the virus fragment, the higher the viral load is considered to be (high).
    The higher the Ct used to detect the virus fragment, the lower the viral load is considered to be (low).
    Thus, the French National Reference Centre (CNR), in the acute phase of the pandemic, estimated that the peak of viral shedding occurred at the onset of symptoms, with an amount of virus corresponding to approximately 108 (100 million) copies of SARS-CoV-2 viral RNA on average (French COVID-19 cohort data) with a variable duration of shedding in the upper airways (from 5 days to more than 5 weeks) [19].
    This number of 108 (100 million) copies/μl corresponds to a very low Ct.
    A Ct of 32 corresponds to 10-15 copies/μl.
    A Ct of 35 corresponds to about 1 copy/μl.
    Above Ct 35, it becomes impossible to isolate a complete virus sequence and culture it!
    In France and in most countries, Ct levels above 35, even 40, are still used even today!
    The French Society of Microbiology (SFM) issued an opinion on September 25, 2020 in which it does not recommend quantitative results, and it recommends to make positive up to a Ct of 37 for a single gene [20]!
    With 1 copy/μl of a sample (Ct 35), without cough, without symptoms, one can understand why all these doctors and scientists say that a positive RT-PCR test means nothing, nothing at all in terms of medicine and clinic!
    Positive RT-PCR tests, without any mention of Ct or its relation to the presence or absence of symptoms, are used as is by our governments as the exclusive argument to apply and justify their policy of severity, austerity, isolation and aggression of our freedoms, with the impossibility to travel, to meet, to live normally!
    There is no medical justification for these decisions, for these governmental choices!
    In an article published on the website of the New York Times (NYT) on Saturday, August 29, American experts from Harvard University are surprised that RT-PCR tests as practiced can serve as tests of contagiousness, even more so as evidence of pandemic progression in the case of SARS-CoV-2 infection [21].
    I’m a Clinical Lab Scientist, COVID-19 Is Fake, Wake Up America!
    According to them, the threshold (Ct) considered results in positive diagnoses in people who do not represent any risk of transmitting the virus!
    The binary “yes/no” answer is not enough, according to this epidemiologist from the Harvard University School of Public Health.
    “It’s the amount of virus that should dictate the course of action for each patient tested. »​
    The amount of virus (viral load); but also and above all the clinical state, symptomatic or not of the person!
    This calls into question the use of the binary result of this RT-PCR test to determine whether a person is contagious and must follow strict isolation measures.
    These questions are being raised by many physicians around the world, not only in the United States but also in France, Belgium (Belgium Health Experts Demand Investigation Of WHO For Faking Coronavirus Pandemic), France, Germany, Italy, the United Kingdom, the United States and the United Kingdom. in Germany, Spain…
    According to them: “We are going to put tens of thousands of people in confinement, in isolation, for nothing. » [22]. 22] And inflict suffering, anguish, economic and psychological dramas by the thousands!
    Most RT-PCR tests set the Ct at 40, according to the NYT. Some set it at 37.
    “Tests with such high thresholds (Ct) may not only detect live virus but also gene fragments, remnants of an old infection that do not represent any particular danger,” the experts said.
    A virologist at the University of California admits that an RT-PCR test with a Ct greater than 35 is too sensitive. “A more reasonable threshold would be between 30 and 35,” she adds.
    Almost no laboratory specifies the Ct (number of amplification cycles performed) or the number of copies of viral RNA per sample μl.
    Here is an example of a laboratory result (approved by Sciensano, the Belgian national reference center) in an RT-PCR negative patient:
    Capture-d%E2%80%99%C3%A9cran-le-2020-10-14-%C3%A0-15.57.40-1024x390.
    No mention of Ct.
    In the NYT, experts compiled three datasets with officials from the states of Massachusetts, New York and Nevada that mention them.
    Conclusion?
    “Up to 90% of the people who tested positive did not carry a virus. »
    The Wadworth Center, a New York State laboratory, analyzed the results of its July tests at the request of the NYT: 794 positive tests with a Ct of 40.
    “With a Ct threshold of 35, approximately half of these PCR tests would no longer be considered positive,” said the NYT.
    “And about 70% would no longer be considered positive with a Ct of 30! “
    In Massachusetts, between 85 and 90% of people who tested positive in July with a Ct of 40 would have been considered negative with a Ct of 30, adds the NYT. And yet, all these people had to isolate themselves, with all the dramatic psychological and economic consequences, while they were not sick and probably not contagious at all.
    In France, the Centre National de Référence (CNR), the French Society of Microbiology (SFM) continue to push Ct to 37 and recommend to laboratories to use only one gene of the virus as a primer.
    I remind you that from Ct 32 onwards, it becomes very difficult to culture the virus or to extract a complete sequence, which shows the completely artificial nature of this positivity of the test, with such high Ct levels, above 30.
    Similar results were reported by researchers from the UK Public Health Agency in an article published on August 13 in Eurosurveillance: “The probability of culturing the virus drops to 8% in samples with Ct levels above 35.” [23]
    In addition, currently, the National Reference Center in France only evaluates the sensitivity of commercially available reagent kits, not their specificity: serious doubts persist about the possibility of cross-reactivity with viruses other than SARS-CoV-2, such as other benign cold coronaviruses. [20]
    It is potentially the same situation in other countries, including Belgium.
    Similarly, mutations in the virus may have invalidated certain primers (genes) used to detect SARS-CoV-2: the manufacturers give no guarantees on this, and if the AFP fast-checking journalists tell you otherwise, test their good faith by asking for these guarantees, these proofs.
    If they have nothing to hide and if what I say is false, this guarantee will be provided to you and will prove their good faith.
    1. We must demand that the RT-PCR results be returned mentioning the Ct used because beyond Ct 30, a positive RT-PCR test means nothing.
    2. We must listen to the scientists and doctors, specialists, virologists who recommend the use of adapted Ct, lower, at 30. An alternative is to obtain the number of copies of viral RNA/μl or /ml sample. [23]
    3. We need to go back to the patient, to the person, to his or her clinical condition (presence or absence of symptoms) and from there to judge the appropriateness of testing and the best way to interpret the result.
    Until there is a better rationale for PCR screening, with a known and appropriate Ct threshold, an asymptomatic person should not be tested in any way.
    Even a symptomatic person should not automatically be tested, as long as they can place themselves in isolation for 7 days.
    Let’s stop this debauchery of RT-PCR testing at too high Ct levels and return to clinical, quality medicine.
    Once we understand how RT-PCR testing works, it becomes impossible to let the current government routine screening strategy, inexplicably supported by the virologists in the safety councils, continue.
    My hope is that, finally, properly informed, more and more people will demand that this strategy be stopped, because it is all of us, enlightened, guided by real benevolence and common sense, who must decide our collective and individual destinies.
    No one else should do it for us, especially when we realize that those who decide are no longer reasonable or rational.
    Summary of important points :
    • The RT-PCR test is a laboratory diagnostic technique that is not well suited to clinical medicine.
    • It is a binary, qualitative diagnostic technique that confirms (positive test) or not (negative test) the presence of an element in the medium being analyzed. In the case of SARS-CoV-2, the element is a fragment of the viral genome, not the virus itself.
    • In medicine, even in an epidemic or pandemic situation, it is dangerous to place tests, examinations, techniques above clinical evaluation (symptoms, signs). It is the opposite that guarantees quality medicine.
    • The main limitation (weakness) of the RT-PCR test, in the current pandemic situation, is its extreme sensitivity (false positive) if a suitable threshold of positivity (Ct) is not chosen. Today, experts recommend using a maximum Ct threshold of 30.
    • This Ct threshold must be informed with the positive RT-PCR result so that the physician knows how to interpret this positive result, especially in an asymptomatic person, in order to avoid unnecessary isolation, quarantine, psychological trauma.
    • In addition to mentioning the Ct used, laboratories must continue to ensure the specificity of their detection kits for SARS-CoV-2, taking into account its most recent mutations, and must continue to use three genes from the viral genome being studied as primers or, if not, mention it.

    Overall Conclusion
    Is the obstinacy of governments to use the current disastrous strategy, systematic screening by RT-PCR, due to ignorance?
    Is it due to stupidity?
    To a kind of cognitive trap trapping their ego?
    In any case, we should be able to question them, and if among the readers of this article there are still honest journalists, or naive politicians, or people who have the possibility to question our rulers, then do so, using these clear and scientific arguments.
    It is all the more incomprehensible that our rulers have surrounded themselves with some of the most experienced specialists in these matters.
    If I have been able to gather this information myself, shared, I remind you, by competent people above all suspicion of conspiracy, such as Hélène Banoun, Pierre Sonigo, Jean-François Toussaint, Christophe De Brouwer, whose intelligence, intellectual honesty and legitimacy cannot be questioned, then the Belgian, French and Quebec scientific advisors, etc., know all this as well.
    So?
    What’s going on?
    Why continue in this distorted direction, obstinately making mistakes?
    It is not insignificant to reimpose confinements, curfews, quarantines, reduced social bubbles, to shake up again our shaky economies, to plunge entire families into precariousness, to sow so much fear and anxiety generating a real state of post-traumatic stress worldwide, to reduce access to care for other pathologies that nevertheless reduce life expectancy much more than COVID-19! [24]
    Is there intent to harm?
    Is there an intention to use the alibi of a pandemic to move humanity towards an outcome it would otherwise never have accepted? In any case, not like that!
    Would this hypothesis, which modern censors will hasten to label “conspiracy”, be the most valid explanation for all this?

    Indeed, if we draw a straight line from the present events, if they are maintained, we could find ourselves once again confined with hundreds, thousands of human beings forced to remain inactive, which, for the professions of catering, entertainment, sales, fairgrounds, itinerants, canvassers, risks being catastrophic with bankruptcies, unemployment, depression, suicides by the hundreds of thousands. [25-26-27-28]
    The impact on education, on our children, on teaching, on medicine with long planned care, operations, treatments to be cancelled, postponed, will be profound and destructive.
    “We risk a looming food crisis if action is not taken quickly.” [29].
    It is time for everyone to come out of this negative trance, this collective hysteria, because famine, poverty, massive unemployment will kill, mow down many more people than SARS-CoV-2!
    Does all this make sense in the face of a disease that is declining, over-diagnosed and misinterpreted by this misuse of overly sensitively calibrated PCR tests?
    For many, the continuous wearing of the mask seems to have become a new norm.
    Even if it is constantly downplayed by some health professionals and fact-checking journalists, other doctors warn of the harmful consequences, both medical and psychological, of this hygienic obsession which, maintained permanently, is in fact an abnormality!
    What a hindrance to social relations, which are the true foundation of a physically and psychologically healthy humanity!
    Some dare to find all this normal, or a lesser price to pay in the face of the pandemic of positive PCR tests.
    Isolation, distancing, masking of the face, impoverishment of emotional communication, fear of touching and kissing even within families, communities, between relatives…
    Spontaneous gestures of daily life hindered and replaced by mechanical and controlled gestures …
    Terrified children, kept in permanent fear and guilt…
    All this will have a deep, lasting and negative impact on human organisms, in their physical, mental, emotional and representation of the world and society.
    This is not normal!
    We cannot let our rulers, for whatever reason, organize our collective suicide any longer.
    Translated from French by Global Research. Original source: Mondialisation.ca
    Dr Pascal Sacré is a physician specialized in critical care, author and renowned public health analyst, Charleroi, Belgium. He is a Research Associate of the entre for Research on Globalization (CRG)

    ****
    Professionals whose references and comments are the basis of this article in its scientific aspect (especially and mainly on RT-PCR):
    1) Hélène Banoun

    https://www.researchgate.net/profile/Helene_Banoun
    PhD, Pharmacist biologist
    Former INSERM Research Officer
    Former intern at the Paris Hospitals
    2) Pierre Sonigo
    Virologist
    Research Director INSERM, worked at the Pasteur Institute
    Heads the Virus Genetics Laboratory in Cochin, Paris.
    Participated in 1985 in the sequencing of the AIDS virus.
    3) Christophe De Brouwer
    PhD in Public Health Science
    Honorary Professor at the School of Public Health at ULB, Belgium
    4) Jean-François Toussaint
    Doctor, Professor of Physiology at the University of Paris-Descartes
    Director of IRMES, Institute for BioMedical Research and Sports Epidemiology
    Former member of the High Council of Public Health
    ***
    Notes (French)
    [1] “Une nette augmentation du nombre de cas dans toutes les provinces et toutes les tranches d’âge”, 7sur7 ACTU Belgique, 5-10-2020
    [2] Le gouvernement belge renforce des mesures anti-Covid, VRT.be ; 6 octobre 2020.
    [3] Non, l’inventeur du test PCR n’a pas dit que sa méthode était inefficace pour détecter les virus, dans Le Monde, 7 octobre 2020
    [4] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.
    [5] https://www.weblyf.com/2020/05/coro...test-kit-from-the-inventor-and-other-experts/
    [6] « The Truth about PCR Test Kit from the Inventor and Other Experts »
    [7] PCR en microbiologie : de l’amplification de l’ADN à l’interprétation du résultat
    [8] COVID : La PCR nasale peut-elle mentir ?, Dr Pascal Sacré, AIMSIB, 30 août 2020.
    [9]
    View: https://www.youtube.com/watch?v=CaAcSJI0oMs&feature=youtu.be
    , 8 octobre 2020. Évolution génomique des virus ARN à l’Institut Pasteur, environ la moitié des nucléotides sont susceptibles d’avoir muté sur les 30 000 nucléotides de l’ARN viral. « Pour l’instant aucune mutation ou délétion n’a été associée à une perte de sévérité de la maladie sur une grande échelle géographique mais de nombreuses publications devraient bientôt préciser ces points. »
    [10] https://www.mediterranee-infection....0/04/FD_Raoult_SARS-CoV-2_EID_Sep2020_vL2.pdf, Article IHU-Méditerranée, Professeur D. Raoult, Dramatic increase in the SARS-CoV-2 mutation rate and low mortality rate during the second epidemic in summer in Marseille, 7 septembre 2020
    Conclusions :
    Dans l’ensemble, comme l’ont récemment souligné Tomaszewski et al. (7) qui ont décrit pour les génomes viraux disponibles jusqu’en mai 2020 un déplacement mutationnel sur la spike et le complexe de réplication vers des gènes codant pour d’autres protéines non structurelles qui interagissent avec les voies de défense de l’hôte, il semble que le taux de mutation du SARS-CoV-2 s’accélère depuis mai, impliquant principalement des mutations C vers U. L’augmentation du taux de mutation du SRAS-CoV-2 génère des génotypes viraux plus éloignés de la souche Wuhan initiale que ceux observés de mars à avril. Cela semble entraîner des épidémies de durée limitée, du moins pour le premier nouveau génotype que nous avons identifié, et est associé à une gravité globalement moindre à ce stade du développement de cette nouvelle épidémie.
    Mutations observed in these seven different viral genotypes are located in most SARS- CoV-2 genes including structural and non-structural genes among which nsp2, nsp3 (predicted phosphoesterase), nsp5 (membrane glycoprotein), nsp12 (RNA-dependent RNA polymerase), S (Spike glycoprotein), ORF3a, E (membrane glycoprotein), M (membrane glycoprotein), ORF8 and N (Nucleocapsid phosphoprotein).
    [11] https://www.researchgate.net/profile/Helene_Banoun Evolution of SARS-CoV-2: Review of mutations, role of the host immune system, octobre 2020, mise à jour par Hélène Banoun,
    PhD, Pharmacien biologiste, ancien Chargé de Recherches INSERM, ancien Interne des Hôpitaux de Paris.
    [12] https://nextstrain.org/, We are incorporating SARS-CoV-2 genomes as soon as they are shared and providing analyses and situation reports. In addition we have developed a number of resources and tools, and are facilitating independent groups to run their own analysis. Please see the main SARS-CoV-2 page for more.
    [13] Tutoriel prélèvement nasopharyngé : Un geste technique, essentiel à la fiabilité du test COVID-19
    [14] Covid-19 : comment fonctionnent les tests et quelles sont leurs utilités ?
    [15] COMMENT FONCTIONNENT LES TESTS DE DÉPISTAGE DU COVID-19 ? 7 avril 2020, Laboratoire de biologie et pharmacologie appliquée (LBPA), Clémence Richetta, maître de conférences au département biologie de l’ENS Paris-Saclay et chercheuse en virologie au LBPA :
    View: https://www.youtube.com/watch?v=hNVDHCf8bGA

    Independent researcher, PhD 9
    Former research fellow at INSERM (French Institute for Health and Medical Research)
    [16] Par Pierre Sonigo, virologiste (un des découvreurs du VIH), MD PhD, CSO at Sebia, clinical diagnostics
    https://www.linkedin.com/pulse/diagnostic-du-covid19-comprendre-les-tests-pcr-leur-et-pierre-sonigo/?trackingId=pTYxDkpvRzKHWZwCzxSIag%3D%3D
    Diagnostic du COVID19 : comprendre les tests PCR, leur interprétation et leurs limites, publié le 16 septembre 2020
    La PCR utilise un principe très particulier : la cible du test, un fragment d’ARN viral, est massivement amplifiée afin de permettre sa détection. Au cours de l’analyse, une réaction enzymatique associée à des « cycles » de variation de température permet une série de « réplications » successives de l’acide nucléique cible. Chaque cycle correspond à une multiplication théorique de la cible par 2. On multiplie donc par 2 en un cycle, par 4 en 2 cycles, par 8 en 3 cycles, par 16 en 4 cycles, et ainsi de suite de manière exponentielle. A l’heure actuelle, l’amplification est généralement pratiquée sur 40 cycles, soit une amplification théorique de 2^40, environ mille milliards de fois ! En réalité, la réplication n’est pas efficace à 100%, mais la cible est amplifiée environ un million de fois, ce qui permet de détecter moins d’une dizaine de fragments d’ARN dans le volume analysé.
    Lorsque l’acide nucléique viral est détectable après un petit nombre de cycles, cela signifie que la quantité de virus dans l’échantillon de départ est grande. Au contraire, lorsqu’il faut un grand nombre de cycles de réplication pour détecter l’ARN viral, cela signifie que l’échantillon de départ contient une quantité de virus très faible. On parle alors en nombre de cycles, ou Ct, qui signifie « cycle time », pour définir, au moins de façon semi quantitative, la quantité d’ARN présent dans l’échantillon de départ. Ainsi, un petit Ct correspond à un grand nombre de copies, un grand Ct à un petit nombre de copies.
    Cette spectaculaire sensibilité n’est pas sans inconvénient et nécessite des précautions particulières. En effet, un échantillon positif amplifié un million de fois contient une très haute concentration de cible et le risque qu’il contamine (carry over) d’autres échantillons est particulièrement élevé. La saturation des laboratoires peut encore accroître ce risque et générer des faux positifs accidentels. Dans ces conditions, il est important que les résultats positifs soient confirmés par un second test, à plus forte raison lorsqu’un test positif présente des conséquences significatives, qu’elles soient médicales, professionnelles ou liées à l’obligation d’isolement.
    La deuxième question importante concernant la PCR, une fois encore conséquence de sa spectaculaire sensibilité, est celle de sa signification clinique. Un sujet parfaitement asymptomatique présentant une PCR positive ne peut être qualifié de « malade », comme on le lit dans les médias qui rapportent la progression de l’épidémie ! Peut-on même parler de « cas » ? C’est pourtant le terme utilisé dans les dénombrements officiels. Ne sommes-nous pas en train d’oublier le patient pour se focaliser sur la technologie ? Est-ce une épidémie d’ARN dans des tubes que nous surveillons ou une maladie grave et potentiellement mortelle ?
    Des publications récentes soulignent que la dose détectable par PCR est inférieure à la dose infectieuse ou contagieuse : aucun virus infectieux n’a pu être retrouvé chez les patients asymptomatiques présentant des tests PCR positifs avec un Ct élevé. Suite à ces résultats, la question du seuil de Ct qui permet de déclarer un échantillon positif est débattue. Peut-on rendre un résultat négatif chez un sujet asymptomatique dont la positivité apparaît au-delà de 35 cycles ? A défaut, est-il utile de retester ces échantillons ? Comme souvent en matière de diagnostic médical, lorsqu’un seuil de positivité est déterminé, faut-il privilégier la sensibilité ou la spécificité du test ?
    De plus, un échantillon confirmé positif d’un point de vue analytique reste un faux positif du point de vue de la clinique, si la personne testée est en parfaite santé, parfois même prêt à affronter une compétition de tennis ou de football professionnels ! La question devient uniquement celle de sa potentielle contagiosité. C’est la question de la transmission éventuelle par des sujets asymptomatiques, qui sans être eux-mêmes en danger, pourraient en représenter un pour les autres.
    Par rapport à cette question, il est important de raisonner quantitativement. La virologie, ce n’est pas du tout ou rien. De manière générale, au cours des infections virales aiguës, le risque de contagion et la gravité de l’infection varient en fonction de la quantité de virus présents dans l’organisme et de leur excrétion dans le milieu extérieur. Quelques copies de virus tapis dans les sinus n’ont pas la dangerosité d’un million projetés par la toux. Un sujet asymptomatique produit moins de virus qu’un sujet symptomatique et les sécrète moins vers l’extérieur. La quantité de virus produite et donc le risque de contagion sont corrélés à la gravité des symptômes. Même si elle n’est pas de zéro, le risque de transmission est donc vraisemblablement faible pour un sujet asymptomatique. Malheureusement, répéter sans cesse que la contagion venant d’un sujet parfaitement asymptomatique est possible sans aucune précision sur le niveau de risque pousse à prendre des mesures disproportionnées avec le risque.
    De même, la stratégie « dépister-isoler » n’est pas réaliste lorsque le dépistage n’est pas suffisamment fiable et surtout lorsque le virus est déjà largement répandu dans la population. Il est bien trop tard pour appliquer une méthode conçue pour bloquer une épidémie à sa naissance. Comme pour une invasion de coccinelles ou de frelons, on ne peut stopper un virus qui est déjà partout avec une passoire trouée à 25% et bouchée par endroits. L’échec de la stratégie actuelle est plutôt lié à sa conception naïve et inapplicable qu’aux mauvais comportements des citoyens.
    Si, comme on l’observe en ce moment, la diffusion virale reprend, faut-il dépister plus massivement ou revoir la stratégie de protection de la population ?
    Cette question ne relève pas de la science. Elle dépend des risques acceptables par un individu ou par un groupe. Si on est dans la recherche du risque minimal, proche de zéro, parce que le risque n’a pas été quantifié, ou pour des raisons de responsabilité juridique, on doit prendre les précautions maximales. Si on accepte un risque même faible, on peut reprendre certaines libertés et protéger ceux qui en ont réellement besoin.
    Le scientifique doit mesurer la grandeur des risques et ne pas se contenter d’affirmer qu’un événement adverse est « possible ». Mais ce n’est pas son rôle de décider si ces risques peuvent être pris par autrui.
    Les tests PCR permettent une détection extrêmement sensible de l’ARN viral. Ils sont indispensables mais ne sont pas la solution ultime et unique qui permettra de contrôler l’épidémie et de gérer efficacement les risques de contagion. Appliquée lorsque le virus est largement disséminé dans la population, la stratégie « dépister isoler » est vouée à l’échec. Du fait de la sensibilité très élevée et des limites de leur spécificité, les tests PCR doivent être pratiqués et interprétés avec précaution, et comme toujours en lien avec le contexte clinique et épidémiologique. N’oublions pas qu’un sujet asymptomatique doit plutôt être considéré comme immunisé que comme malade.
    [17] Les tests RT-PCR du Covid-19 se révèlent être de très mauvais tests de contagiosité, Xavier Boisinet, mis à jour le 3/9/2020.
    [18] De nombreuses publications partagées des milliers de fois sur les réseaux sociaux en quelques jours affirment que « 90% » des personnes déclarées positives au Covid-19 ont en fait des charges virales trop basses pour être « malades » ou « contagieuses ». C’est faux.
    [19] Mise au point du CNR sur la réalisation des prélèvements et la sensibilité des tests RT-PCR pour la détection du SARS-CoV-2, 9 mai 2020
    [20] Avis du 25 septembre 2020 de la Société Française de Microbiologie (SFM) relatif à l’interprétation de la valeur de Ct (estimation de la charge virale) obtenue en cas de RT-PCR SARS-CoV-2 positive sur les prélèvements cliniques réalisés à des fins diagnostiques ou de dépistage, 25 septembre 2020
    [21] Coronavirus – Les tests PCR inadaptés contre l’épidémie? « Jusqu’à 90% de personnes testées ne seraient pas contagieuses », basé sur une étude d’une équipe de Harvard ( Harvard TH Chan School of Public Health) de Michael Mina, département d’épidémiologie, je vous mets en fichier joint le PDF correspondant, une étude, reprise par le NY Times :
    « Pour eux, la limite du test PCR (prélèvement par voie nasale ou salivaire) réside dans la brutalité et la simplicité du résultat qu’il donne. La personne est soit positive, soit négative. Pas plus de renseignement, notamment sur la contagiosité du malade.
    Or, les scientifiques d’Harvard soulèvent le problème de la quantité de virus que ce test PCR ne donne pas et qui pourrait, selon eux, permettre de donner des clés supplémentaires pour contrer l’épidémie.
    « Les tests standards diagnostiquent un grand nombre de personnes qui peuvent être porteuses de quantités relativement insignifiantes du virus », explique ainsi le Dr. Michael Mina, épidémiologiste à la Harvard TH Chan School of Public Health
    . »
    [22] « Au rythme actuel avec nos tests RT-PCR, nous allons confiner des dizaines de milliers de gens pour rien », alerte le Dr. Yvon Le Flohic, manuel Moragues, 3 septembre 2020.
    [23] Tests de diagnostic ultra sensibles, les tests RT-PCR sortent positifs même pour des individus qui portent trop peu de virus pour être encore contagieux. Pour en faire de meilleurs tests de contagiosité, certains appellent à baisser leur seuil de détection. Est-ce une bonne idée ? Quelles sont les limites de cette solution ? Décryptage.Xavier Boinivet, 15 septembre 2020
    [24] Jean-Luc Gala (UCL) estime que les futures mesures de la Celeval, tel le lockdown, vont tuer l’économie, provoquer des suicides et déstabiliser l’État. Le Celeval, ou Cellule d’évaluation, est le groupe d’experts qui conseillent le gouvernement belge dans la gestion du COVID.
    [25] L’OMS plaide pour éviter à tout prix les confinements : ‘Cela ne rend que les pauvres plus pauvres’
    [26] Voici comment la pandémie risque de faire exploser la pauvreté mondiale, une première en 22 ans
    [27] ‘Le coronavirus menace 500 millions de personnes de pauvreté’, prévient l’Oxfam. Ce n’est pas le coronavirus, la menace, mais l’attitude de nos gouvernants face au coronavirus !
    [28] Le chômage de masse est désormais mondial
    [29] ‘Nous risquons une crise alimentaire imminente si des mesures ne sont pas prises rapidement’. Encore une fois, ce n’est pas à cause du coronavirus, mais à cause de notre attitude face à cette crise.
    By Dr. Pascal Sacré
    Global Research, February 16, 2021
    Global Research 5 November 2020
    Theme: Science and Medicine
    printme.
    5386 1050 641

    8363
    RT-PCR-pr%C3%A9paration-400x267.
    Introduction: using a technique to lock down society
    All current propaganda on the COVID-19 pandemic is based on an assumption that is considered obvious, true and no longer questioned:

    Positive RT-PCR test means being sick with COVID. This assumption is misleading.
    Very few people, including doctors, understand how a PCR test works.
    RT-PCR means Real Time-Polymerase Chain Reaction.
    In French, it means: Réaction de Polymérisation en Chaîne en Temps Réel.
    In medicine, we use this tool mainly to diagnose a viral infection.
    Starting from a clinical situation with the presence or absence of particular symptoms in a patient, we consider different diagnoses based on tests.
    In the case of certain infections, particularly viral infections, we use the RT-PCR technique to confirm a diagnostic hypothesis suggested by a clinical picture.
    We do not routinely perform RT-PCR on any patient who is overheated, coughing or has an inflammatory syndrome!
    It is a laboratory, molecular biology technique of gene amplification because it looks for gene traces (DNA or RNA) by amplifying them.
    In addition to medicine, other fields of application are genetics, research, industry and forensics.
    The technique is carried out in a specialized laboratory, it cannot be done in any laboratory, even a hospital. This entails a certain cost, and a delay sometimes of several days between the sample and the result.
    Today, since the emergence of the new disease called COVID-19 (COrona VIrus Disease-2019), the RT-PCR diagnostic technique is used to define positive cases, confirmed as SARS-CoV-2 (coronavirus responsible for the new acute respiratory distress syndrome called COVID-19).
    These positive cases are assimilated to COVID-19 cases, some of whom are hospitalized or even admitted to intensive care units.
    Official postulate of our managers: positive RT-PCR cases = COVID-19 patients. [1]
    This is the starting postulate, the premise of all official propaganda, which justifies all restrictive government measures: isolation, confinement, quarantine, mandatory masks, color codes by country and travel bans, tracking, social distances in companies, stores and even, even more importantly, in schools [2].
    This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.
    Technical aspects: to better understand and not be manipulated
    The PCR technique was developed by chemist Kary B. Mullis in 1986. Kary Mullis was awarded the Nobel Prize in Chemistry in 1993.
    Although this is disputed [3], Kary Mullis himself is said to have criticized the interest of PCR as a diagnostic tool for an infection, especially a viral one.
    He stated that if PCR was a good tool for research, it was a very bad tool in medicine, in the clinic [4].
    Mullis was referring to the AIDS virus (HIV retrovirus or HIV) [5], before the COVID-19 pandemic, but this opinion on the limitation of the technique in viral infections [6], by its creator, cannot be dismissed out of hand; it must be taken into account!
    PCR was perfected in 1992.
    As the analysis can be performed in real time, continuously, it becomes RT (Real-Time) – PCR, even more efficient.
    It can be done from any molecule, including those of the living, the nucleic acids that make up the genes:
    • DNA (deoxyribonucleic acid)
    • RNA (Ribonucleic Acid)
    Viruses are not considered as “living” beings, they are packets of information (DNA or RNA) forming a genome.
    It is by an amplification technique (multiplication) that the molecule sought is highlighted and this point is very important.
    RT-PCR is an amplification technique [7].

    If there is DNA or RNA of the desired element in a sample, it is not identifiable as such.
    This DNA or RNA must be amplified (multiplied) a certain number of times, sometimes a very large number of times, before it can be detected. From a minute trace, up to billions of copies of a specific sample can be obtained, but this does not mean that there is all that amount in the organism being tested.
    In the case of COVID-19, the element sought by RT-PCR is SARS-CoV-2, an RNA virus [8].
    There are DNA viruses such as Herpes and Varicella viruses.
    The most well known RNA viruses, in addition to coronaviruses, are Influenza, Measles, EBOLA, ZIKA viruses.
    In the case of SARS-CoV-2, RNA virus, an additional specific step is required, a transcription of RNA into DNA by means of an enzyme, Reverse Transcriptase.
    This step precedes the amplification phase.
    It is not the whole virus that is identified, but sequences of its viral genome.
    This does not mean that this gene sequence, a fragment of the virus, is not specific to the virus being sought, but it is an important nuance nonetheless:
    RT-PCR does not reveal any virus, but only parts, specific gene sequences of the virus.
    At the beginning of the year, the SARS-CoV-2 genome was sequenced.
    It consists of about 30,000 base pairs. The nucleic acid (DNA-RNA), the component of the genes, is a sequence of bases. In comparison, the human genome has more than 3 billion base pairs.
    Teams are continuously monitoring the evolution of the SARS-CoV-2 viral genome as it evolves [9-10-11], through the mutations it undergoes. Today, there are many variants [12].
    By taking a few specific genes from the SARS-CoV-2 genome, it is possible to initiate RT-PCR on a sample from the respiratory tract.
    For COVID-19 disease, which has a nasopharyngeal (nose) and oropharyngeal (mouth) entry point, the sample should be taken from the upper respiratory tract as deeply as possible in order to avoid contamination by saliva in particular.
    rt-pcr-tes. A
    ll the people tested said that it is very painful [13].
    The Gold Standard (preferred site for sampling) is the nasopharyngeal (nasal) approach, the most painful route.
    If there is a contraindication to the nasal approach, or preferably to the individual being tested, depending on the official organs, the oropharyngeal approach (through the mouth) is also acceptable. The test may trigger a nausea/vomiting reflex in the individual being tested.
    Normally, for the result of an RT-PCR test to be considered reliable, amplification from 3 different genes (primers) of the virus under investigation is required.
    “The primers are single-stranded DNA sequences specific to the virus. They guarantee the specificity of the amplification reaction. » [14]​
    “The first test developed at La Charité in Berlin by Dr. Victor Corman and his associates in January 2020 allows to highlight the RNA sequences present in 3 genes of the virus called E, RdRp and N. To know if the sequences of these genes are present in the RNA samples collected, it is necessary to amplify the sequences of these 3 genes in order to obtain a signal sufficient for their detection and quantification. »[15].​
    The essential notion of Cycle Time or Cycle Threshold or Ct positivity threshold [16].
    An RT-PCR test is negative (no traces of the desired element) or positive (presence of traces of the desired element).
    However, even if the desired element is present in a minute, negligible quantity, the principle of RT-PCR is to be able to finally highlight it by continuing the amplification cycles as much as necessary.
    RT-PCR can push up to 60 amplification cycles, or even more!
    Here is how it works:
    Cycle 1: target x 2 (2 copies)
    Cycle 2: target x 4 (4 copies)
    Cycle 3: target x 8 (8 copies)
    Cycle 4: target x 16 (16 copies)
    Cycle 5; target x 32 (32 copies)
    Etc exponentially up to 40 to 60 cycles!
    When we say that the Ct (Cycle Time or Cycle Threshold or RT-PCR positivity threshold) is equal to 40, it means that the laboratory has used 40 amplification cycles, i.e. obtained 240 copies.
    This is what underlies the sensitivity of the RT-PCR assay.
    While it is true that in medicine we like to have high specificity and sensitivity of the tests to avoid false positives and false negatives, in the case of COVID-19 disease, this hypersensitivity of the RT-PCR test caused by the number of amplification cycles used has backfired.
    This over-sensitivity of the RT-PCR test is deleterious and misleading!
    It detaches us from the medical reality which must remain based on the real clinical state of the person: is the person ill, does he or she have symptoms?
    That is the most important thing!
    As I said at the beginning of the article, in medicine we always start from the person: we examine him/her, we collect his/her symptoms (complaints-anamnesis) and objective clinical signs (examination) and on the basis of a clinical reflection in which scientific knowledge and experience intervene, we make diagnostic hypotheses.
    Only then do we prescribe the most appropriate tests, based on this clinical reflection.
    We constantly compare the test results with the patient’s clinical condition (symptoms and signs), which takes precedence over everything else when it comes to our decisions and treatments.
    Today, our governments, supported by their scientific safety advice, are making us do the opposite and put the test first, followed by a clinical reflection necessarily influenced by this prior test, whose weaknesses we have just seen, particularly its hypersensitivity.
    None of my clinical colleagues can contradict me.
    Apart from very special cases such as genetic screening for certain categories of populations (age groups, sex) and certain cancers or family genetic diseases, we always work in this direction: from the person (symptoms, signs) to the appropriate tests, never the other way around.
    This is the conclusion of an article in the Swiss Medical Journal (RMS) published in 2007, written by doctors Katia Jaton and Gilbert Greub microbiologists from the University of Lausanne :
    PCR in microbiology: from DNA amplification to result interpretation:
    “To interpret the result of a PCR, it is essential that clinicians and microbiologists share their experiences, so that the analytical and clinical levels of interpretation can be combined.”​
    It would be indefensible to give everyone an electrocardiogram to screen everyone who might have a heart attack one day.
    On the other hand, in certain clinical contexts or on the basis of specific evocative symptoms, there, yes, an electrocardiogram can be beneficial.
    Back to RT-PCR and Ct (Cycle Time or Cycle Threshold).
    In the case of an infectious disease, especially a viral one, the notion of contagiousness is another important element.
    Since some scientific circles consider that an asymptomatic person can transmit the virus, they believe it is important to test for the presence of virus, even if the person is asymptomatic, thus extending the indication of RT-PCR to everyone.
    Are RT-PCR tests good tests for contagiousness? [17]
    This question brings us back to the notion of viral load and therefore Ct.
    The relationship between contagiousness and viral load is disputed by some people [18] and no formal proof, to date, allows us to make a decision.
    However, common sense gives obvious credence to the notion that the more virus a person has inside him or her, especially in the upper airways (oropharynx and nasopharynx), with symptoms such as coughing and sneezing, the higher the risk of contagiousness, proportional to the viral load and the importance of the person’s symptoms.
    This is called common sense, and although modern medicine has benefited greatly from the contribution of science through statistics and Evidence-Based Medicine (EBM), it is still based primarily on common sense, experience and empiricism.
    Medicine is the art of healing.
    No test measures the amount of virus in the sample!
    RT-PCR is qualitative: positive (presence of the virus) or negative (absence of the virus).
    This notion of quantity, therefore of viral load, can be estimated indirectly by the number of amplification cycles (Ct) used to highlight the virus sought.
    The lower the Ct used to detect the virus fragment, the higher the viral load is considered to be (high).
    The higher the Ct used to detect the virus fragment, the lower the viral load is considered to be (low).
    Thus, the French National Reference Centre (CNR), in the acute phase of the pandemic, estimated that the peak of viral shedding occurred at the onset of symptoms, with an amount of virus corresponding to approximately 108 (100 million) copies of SARS-CoV-2 viral RNA on average (French COVID-19 cohort data) with a variable duration of shedding in the upper airways (from 5 days to more than 5 weeks) [19].
    This number of 108 (100 million) copies/μl corresponds to a very low Ct.
    A Ct of 32 corresponds to 10-15 copies/μl.
    A Ct of 35 corresponds to about 1 copy/μl.
    Above Ct 35, it becomes impossible to isolate a complete virus sequence and culture it!
    In France and in most countries, Ct levels above 35, even 40, are still used even today!
    The French Society of Microbiology (SFM) issued an opinion on September 25, 2020 in which it does not recommend quantitative results, and it recommends to make positive up to a Ct of 37 for a single gene [20]!
    With 1 copy/μl of a sample (Ct 35), without cough, without symptoms, one can understand why all these doctors and scientists say that a positive RT-PCR test means nothing, nothing at all in terms of medicine and clinic!
    Positive RT-PCR tests, without any mention of Ct or its relation to the presence or absence of symptoms, are used as is by our governments as the exclusive argument to apply and justify their policy of severity, austerity, isolation and aggression of our freedoms, with the impossibility to travel, to meet, to live normally!
    There is no medical justification for these decisions, for these governmental choices!
    In an article published on the website of the New York Times (NYT) on Saturday, August 29, American experts from Harvard University are surprised that RT-PCR tests as practiced can serve as tests of contagiousness, even more so as evidence of pandemic progression in the case of SARS-CoV-2 infection [21].
    I’m a Clinical Lab Scientist, COVID-19 Is Fake, Wake Up America!
    According to them, the threshold (Ct) considered results in positive diagnoses in people who do not represent any risk of transmitting the virus!
    The binary “yes/no” answer is not enough, according to this epidemiologist from the Harvard University School of Public Health.
    “It’s the amount of virus that should dictate the course of action for each patient tested. »​
    The amount of virus (viral load); but also and above all the clinical state, symptomatic or not of the person!
    This calls into question the use of the binary result of this RT-PCR test to determine whether a person is contagious and must follow strict isolation measures.
    These questions are being raised by many physicians around the world, not only in the United States but also in France, Belgium (Belgium Health Experts Demand Investigation Of WHO For Faking Coronavirus Pandemic), France, Germany, Italy, the United Kingdom, the United States and the United Kingdom. in Germany, Spain…
    According to them: “We are going to put tens of thousands of people in confinement, in isolation, for nothing. » [22]. 22] And inflict suffering, anguish, economic and psychological dramas by the thousands!
    Most RT-PCR tests set the Ct at 40, according to the NYT. Some set it at 37.
    “Tests with such high thresholds (Ct) may not only detect live virus but also gene fragments, remnants of an old infection that do not represent any particular danger,” the experts said.
    A virologist at the University of California admits that an RT-PCR test with a Ct greater than 35 is too sensitive. “A more reasonable threshold would be between 30 and 35,” she adds.
    Almost no laboratory specifies the Ct (number of amplification cycles performed) or the number of copies of viral RNA per sample μl.
    Here is an example of a laboratory result (approved by Sciensano, the Belgian national reference center) in an RT-PCR negative patient:
    Capture-d%E2%80%99%C3%A9cran-le-2020-10-14-%C3%A0-15.57.40-1024x390.
    No mention of Ct.
    In the NYT, experts compiled three datasets with officials from the states of Massachusetts, New York and Nevada that mention them.
    Conclusion?
    “Up to 90% of the people who tested positive did not carry a virus. »
    The Wadworth Center, a New York State laboratory, analyzed the results of its July tests at the request of the NYT: 794 positive tests with a Ct of 40.
    “With a Ct threshold of 35, approximately half of these PCR tests would no longer be considered positive,” said the NYT.
    “And about 70% would no longer be considered positive with a Ct of 30! “
    In Massachusetts, between 85 and 90% of people who tested positive in July with a Ct of 40 would have been considered negative with a Ct of 30, adds the NYT. And yet, all these people had to isolate themselves, with all the dramatic psychological and economic consequences, while they were not sick and probably not contagious at all.
    In France, the Centre National de Référence (CNR), the French Society of Microbiology (SFM) continue to push Ct to 37 and recommend to laboratories to use only one gene of the virus as a primer.
    I remind you that from Ct 32 onwards, it becomes very difficult to culture the virus or to extract a complete sequence, which shows the completely artificial nature of this positivity of the test, with such high Ct levels, above 30.
    Similar results were reported by researchers from the UK Public Health Agency in an article published on August 13 in Eurosurveillance: “The probability of culturing the virus drops to 8% in samples with Ct levels above 35.” [23]
    In addition, currently, the National Reference Center in France only evaluates the sensitivity of commercially available reagent kits, not their specificity: serious doubts persist about the possibility of cross-reactivity with viruses other than SARS-CoV-2, such as other benign cold coronaviruses. [20]
    It is potentially the same situation in other countries, including Belgium.
    Similarly, mutations in the virus may have invalidated certain primers (genes) used to detect SARS-CoV-2: the manufacturers give no guarantees on this, and if the AFP fast-checking journalists tell you otherwise, test their good faith by asking for these guarantees, these proofs.
    If they have nothing to hide and if what I say is false, this guarantee will be provided to you and will prove their good faith.
    1. We must demand that the RT-PCR results be returned mentioning the Ct used because beyond Ct 30, a positive RT-PCR test means nothing.
    2. We must listen to the scientists and doctors, specialists, virologists who recommend the use of adapted Ct, lower, at 30. An alternative is to obtain the number of copies of viral RNA/μl or /ml sample. [23]
    3. We need to go back to the patient, to the person, to his or her clinical condition (presence or absence of symptoms) and from there to judge the appropriateness of testing and the best way to interpret the result.
    Until there is a better rationale for PCR screening, with a known and appropriate Ct threshold, an asymptomatic person should not be tested in any way.
    Even a symptomatic person should not automatically be tested, as long as they can place themselves in isolation for 7 days.
    Let’s stop this debauchery of RT-PCR testing at too high Ct levels and return to clinical, quality medicine.
    Once we understand how RT-PCR testing works, it becomes impossible to let the current government routine screening strategy, inexplicably supported by the virologists in the safety councils, continue.
    My hope is that, finally, properly informed, more and more people will demand that this strategy be stopped, because it is all of us, enlightened, guided by real benevolence and common sense, who must decide our collective and individual destinies.
    No one else should do it for us, especially when we realize that those who decide are no longer reasonable or rational.
    Summary of important points :
    • The RT-PCR test is a laboratory diagnostic technique that is not well suited to clinical medicine.
    • It is a binary, qualitative diagnostic technique that confirms (positive test) or not (negative test) the presence of an element in the medium being analyzed. In the case of SARS-CoV-2, the element is a fragment of the viral genome, not the virus itself.
    • In medicine, even in an epidemic or pandemic situation, it is dangerous to place tests, examinations, techniques above clinical evaluation (symptoms, signs). It is the opposite that guarantees quality medicine.
    • The main limitation (weakness) of the RT-PCR test, in the current pandemic situation, is its extreme sensitivity (false positive) if a suitable threshold of positivity (Ct) is not chosen. Today, experts recommend using a maximum Ct threshold of 30.
    • This Ct threshold must be informed with the positive RT-PCR result so that the physician knows how to interpret this positive result, especially in an asymptomatic person, in order to avoid unnecessary isolation, quarantine, psychological trauma.
    • In addition to mentioning the Ct used, laboratories must continue to ensure the specificity of their detection kits for SARS-CoV-2, taking into account its most recent mutations, and must continue to use three genes from the viral genome being studied as primers or, if not, mention it.

    Overall Conclusion
    Is the obstinacy of governments to use the current disastrous strategy, systematic screening by RT-PCR, due to ignorance?
    Is it due to stupidity?
    To a kind of cognitive trap trapping their ego?
    In any case, we should be able to question them, and if among the readers of this article there are still honest journalists, or naive politicians, or people who have the possibility to question our rulers, then do so, using these clear and scientific arguments.
    It is all the more incomprehensible that our rulers have surrounded themselves with some of the most experienced specialists in these matters.
    If I have been able to gather this information myself, shared, I remind you, by competent people above all suspicion of conspiracy, such as Hélène Banoun, Pierre Sonigo, Jean-François Toussaint, Christophe De Brouwer, whose intelligence, intellectual honesty and legitimacy cannot be questioned, then the Belgian, French and Quebec scientific advisors, etc., know all this as well.
    So?
    What’s going on?
    Why continue in this distorted direction, obstinately making mistakes?
    It is not insignificant to reimpose confinements, curfews, quarantines, reduced social bubbles, to shake up again our shaky economies, to plunge entire families into precariousness, to sow so much fear and anxiety generating a real state of post-traumatic stress worldwide, to reduce access to care for other pathologies that nevertheless reduce life expectancy much more than COVID-19! [24]
    Is there intent to harm?
    Is there an intention to use the alibi of a pandemic to move humanity towards an outcome it would otherwise never have accepted? In any case, not like that!
    Would this hypothesis, which modern censors will hasten to label “conspiracy”, be the most valid explanation for all this?

    Indeed, if we draw a straight line from the present events, if they are maintained, we could find ourselves once again confined with hundreds, thousands of human beings forced to remain inactive, which, for the professions of catering, entertainment, sales, fairgrounds, itinerants, canvassers, risks being catastrophic with bankruptcies, unemployment, depression, suicides by the hundreds of thousands. [25-26-27-28]
    The impact on education, on our children, on teaching, on medicine with long planned care, operations, treatments to be cancelled, postponed, will be profound and destructive.
    “We risk a looming food crisis if action is not taken quickly.” [29].
    It is time for everyone to come out of this negative trance, this collective hysteria, because famine, poverty, massive unemployment will kill, mow down many more people than SARS-CoV-2!
    Does all this make sense in the face of a disease that is declining, over-diagnosed and misinterpreted by this misuse of overly sensitively calibrated PCR tests?
    For many, the continuous wearing of the mask seems to have become a new norm.
    Even if it is constantly downplayed by some health professionals and fact-checking journalists, other doctors warn of the harmful consequences, both medical and psychological, of this hygienic obsession which, maintained permanently, is in fact an abnormality!
    What a hindrance to social relations, which are the true foundation of a physically and psychologically healthy humanity!
    Some dare to find all this normal, or a lesser price to pay in the face of the pandemic of positive PCR tests.
    Isolation, distancing, masking of the face, impoverishment of emotional communication, fear of touching and kissing even within families, communities, between relatives…
    Spontaneous gestures of daily life hindered and replaced by mechanical and controlled gestures …
    Terrified children, kept in permanent fear and guilt…
    All this will have a deep, lasting and negative impact on human organisms, in their physical, mental, emotional and representation of the world and society.
    This is not normal!
    We cannot let our rulers, for whatever reason, organize our collective suicide any longer.
    Translated from French by Global Research. Original source: Mondialisation.ca
    Dr Pascal Sacré is a physician specialized in critical care, author and renowned public health analyst, Charleroi, Belgium. He is a Research Associate of the entre for Research on Globalization (CRG)

    ****
    Professionals whose references and comments are the basis of this article in its scientific aspect (especially and mainly on RT-PCR):
    1) Hélène Banoun

    https://www.researchgate.net/profile/Helene_Banoun
    PhD, Pharmacist biologist
    Former INSERM Research Officer
    Former intern at the Paris Hospitals
    2) Pierre Sonigo
    Virologist
    Research Director INSERM, worked at the Pasteur Institute
    Heads the Virus Genetics Laboratory in Cochin, Paris.
    Participated in 1985 in the sequencing of the AIDS virus.
    3) Christophe De Brouwer
    PhD in Public Health Science
    Honorary Professor at the School of Public Health at ULB, Belgium
    4) Jean-François Toussaint
    Doctor, Professor of Physiology at the University of Paris-Descartes
    Director of IRMES, Institute for BioMedical Research and Sports Epidemiology
    Former member of the High Council of Public Health
    ***
    Notes (French)
    [1] “Une nette augmentation du nombre de cas dans toutes les provinces et toutes les tranches d’âge”, 7sur7 ACTU Belgique, 5-10-2020
    [2] Le gouvernement belge renforce des mesures anti-Covid, VRT.be ; 6 octobre 2020.
    [3] Non, l’inventeur du test PCR n’a pas dit que sa méthode était inefficace pour détecter les virus, dans Le Monde, 7 octobre 2020
    [4] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.
    [5] https://www.weblyf.com/2020/05/coro...test-kit-from-the-inventor-and-other-experts/
    [6] « The Truth about PCR Test Kit from the Inventor and Other Experts »
    [7] PCR en microbiologie : de l’amplification de l’ADN à l’interprétation du résultat
    [8] COVID : La PCR nasale peut-elle mentir ?, Dr Pascal Sacré, AIMSIB, 30 août 2020.
    [9]
    View: https://www.youtube.com/watch?v=CaAcSJI0oMs&feature=youtu.be
    , 8 octobre 2020. Évolution génomique des virus ARN à l’Institut Pasteur, environ la moitié des nucléotides sont susceptibles d’avoir muté sur les 30 000 nucléotides de l’ARN viral. « Pour l’instant aucune mutation ou délétion n’a été associée à une perte de sévérité de la maladie sur une grande échelle géographique mais de nombreuses publications devraient bientôt préciser ces points. »
    [10] https://www.mediterranee-infection....0/04/FD_Raoult_SARS-CoV-2_EID_Sep2020_vL2.pdf, Article IHU-Méditerranée, Professeur D. Raoult, Dramatic increase in the SARS-CoV-2 mutation rate and low mortality rate during the second epidemic in summer in Marseille, 7 septembre 2020
    Conclusions :
    Dans l’ensemble, comme l’ont récemment souligné Tomaszewski et al. (7) qui ont décrit pour les génomes viraux disponibles jusqu’en mai 2020 un déplacement mutationnel sur la spike et le complexe de réplication vers des gènes codant pour d’autres protéines non structurelles qui interagissent avec les voies de défense de l’hôte, il semble que le taux de mutation du SARS-CoV-2 s’accélère depuis mai, impliquant principalement des mutations C vers U. L’augmentation du taux de mutation du SRAS-CoV-2 génère des génotypes viraux plus éloignés de la souche Wuhan initiale que ceux observés de mars à avril. Cela semble entraîner des épidémies de durée limitée, du moins pour le premier nouveau génotype que nous avons identifié, et est associé à une gravité globalement moindre à ce stade du développement de cette nouvelle épidémie.
    Mutations observed in these seven different viral genotypes are located in most SARS- CoV-2 genes including structural and non-structural genes among which nsp2, nsp3 (predicted phosphoesterase), nsp5 (membrane glycoprotein), nsp12 (RNA-dependent RNA polymerase), S (Spike glycoprotein), ORF3a, E (membrane glycoprotein), M (membrane glycoprotein), ORF8 and N (Nucleocapsid phosphoprotein).
    [11] https://www.researchgate.net/profile/Helene_Banoun Evolution of SARS-CoV-2: Review of mutations, role of the host immune system, octobre 2020, mise à jour par Hélène Banoun,
    PhD, Pharmacien biologiste, ancien Chargé de Recherches INSERM, ancien Interne des Hôpitaux de Paris.
    [12] https://nextstrain.org/, We are incorporating SARS-CoV-2 genomes as soon as they are shared and providing analyses and situation reports. In addition we have developed a number of resources and tools, and are facilitating independent groups to run their own analysis. Please see the main SARS-CoV-2 page for more.
    [13] Tutoriel prélèvement nasopharyngé : Un geste technique, essentiel à la fiabilité du test COVID-19
    [14] Covid-19 : comment fonctionnent les tests et quelles sont leurs utilités ?
    [15] COMMENT FONCTIONNENT LES TESTS DE DÉPISTAGE DU COVID-19 ? 7 avril 2020, Laboratoire de biologie et pharmacologie appliquée (LBPA), Clémence Richetta, maître de conférences au département biologie de l’ENS Paris-Saclay et chercheuse en virologie au LBPA :
    View: https://www.youtube.com/watch?v=hNVDHCf8bGA

    Independent researcher, PhD 9
    Former research fellow at INSERM (French Institute for Health and Medical Research)
    [16] Par Pierre Sonigo, virologiste (un des découvreurs du VIH), MD PhD, CSO at Sebia, clinical diagnostics
    https://www.linkedin.com/pulse/diagnostic-du-covid19-comprendre-les-tests-pcr-leur-et-pierre-sonigo/?trackingId=pTYxDkpvRzKHWZwCzxSIag%3D%3D
    Diagnostic du COVID19 : comprendre les tests PCR, leur interprétation et leurs limites, publié le 16 septembre 2020
    La PCR utilise un principe très particulier : la cible du test, un fragment d’ARN viral, est massivement amplifiée afin de permettre sa détection. Au cours de l’analyse, une réaction enzymatique associée à des « cycles » de variation de température permet une série de « réplications » successives de l’acide nucléique cible. Chaque cycle correspond à une multiplication théorique de la cible par 2. On multiplie donc par 2 en un cycle, par 4 en 2 cycles, par 8 en 3 cycles, par 16 en 4 cycles, et ainsi de suite de manière exponentielle. A l’heure actuelle, l’amplification est généralement pratiquée sur 40 cycles, soit une amplification théorique de 2^40, environ mille milliards de fois ! En réalité, la réplication n’est pas efficace à 100%, mais la cible est amplifiée environ un million de fois, ce qui permet de détecter moins d’une dizaine de fragments d’ARN dans le volume analysé.
    Lorsque l’acide nucléique viral est détectable après un petit nombre de cycles, cela signifie que la quantité de virus dans l’échantillon de départ est grande. Au contraire, lorsqu’il faut un grand nombre de cycles de réplication pour détecter l’ARN viral, cela signifie que l’échantillon de départ contient une quantité de virus très faible. On parle alors en nombre de cycles, ou Ct, qui signifie « cycle time », pour définir, au moins de façon semi quantitative, la quantité d’ARN présent dans l’échantillon de départ. Ainsi, un petit Ct correspond à un grand nombre de copies, un grand Ct à un petit nombre de copies.
    Cette spectaculaire sensibilité n’est pas sans inconvénient et nécessite des précautions particulières. En effet, un échantillon positif amplifié un million de fois contient une très haute concentration de cible et le risque qu’il contamine (carry over) d’autres échantillons est particulièrement élevé. La saturation des laboratoires peut encore accroître ce risque et générer des faux positifs accidentels. Dans ces conditions, il est important que les résultats positifs soient confirmés par un second test, à plus forte raison lorsqu’un test positif présente des conséquences significatives, qu’elles soient médicales, professionnelles ou liées à l’obligation d’isolement.
    La deuxième question importante concernant la PCR, une fois encore conséquence de sa spectaculaire sensibilité, est celle de sa signification clinique. Un sujet parfaitement asymptomatique présentant une PCR positive ne peut être qualifié de « malade », comme on le lit dans les médias qui rapportent la progression de l’épidémie ! Peut-on même parler de « cas » ? C’est pourtant le terme utilisé dans les dénombrements officiels. Ne sommes-nous pas en train d’oublier le patient pour se focaliser sur la technologie ? Est-ce une épidémie d’ARN dans des tubes que nous surveillons ou une maladie grave et potentiellement mortelle ?
    Des publications récentes soulignent que la dose détectable par PCR est inférieure à la dose infectieuse ou contagieuse : aucun virus infectieux n’a pu être retrouvé chez les patients asymptomatiques présentant des tests PCR positifs avec un Ct élevé. Suite à ces résultats, la question du seuil de Ct qui permet de déclarer un échantillon positif est débattue. Peut-on rendre un résultat négatif chez un sujet asymptomatique dont la positivité apparaît au-delà de 35 cycles ? A défaut, est-il utile de retester ces échantillons ? Comme souvent en matière de diagnostic médical, lorsqu’un seuil de positivité est déterminé, faut-il privilégier la sensibilité ou la spécificité du test ?
    De plus, un échantillon confirmé positif d’un point de vue analytique reste un faux positif du point de vue de la clinique, si la personne testée est en parfaite santé, parfois même prêt à affronter une compétition de tennis ou de football professionnels ! La question devient uniquement celle de sa potentielle contagiosité. C’est la question de la transmission éventuelle par des sujets asymptomatiques, qui sans être eux-mêmes en danger, pourraient en représenter un pour les autres.
    Par rapport à cette question, il est important de raisonner quantitativement. La virologie, ce n’est pas du tout ou rien. De manière générale, au cours des infections virales aiguës, le risque de contagion et la gravité de l’infection varient en fonction de la quantité de virus présents dans l’organisme et de leur excrétion dans le milieu extérieur. Quelques copies de virus tapis dans les sinus n’ont pas la dangerosité d’un million projetés par la toux. Un sujet asymptomatique produit moins de virus qu’un sujet symptomatique et les sécrète moins vers l’extérieur. La quantité de virus produite et donc le risque de contagion sont corrélés à la gravité des symptômes. Même si elle n’est pas de zéro, le risque de transmission est donc vraisemblablement faible pour un sujet asymptomatique. Malheureusement, répéter sans cesse que la contagion venant d’un sujet parfaitement asymptomatique est possible sans aucune précision sur le niveau de risque pousse à prendre des mesures disproportionnées avec le risque.
    De même, la stratégie « dépister-isoler » n’est pas réaliste lorsque le dépistage n’est pas suffisamment fiable et surtout lorsque le virus est déjà largement répandu dans la population. Il est bien trop tard pour appliquer une méthode conçue pour bloquer une épidémie à sa naissance. Comme pour une invasion de coccinelles ou de frelons, on ne peut stopper un virus qui est déjà partout avec une passoire trouée à 25% et bouchée par endroits. L’échec de la stratégie actuelle est plutôt lié à sa conception naïve et inapplicable qu’aux mauvais comportements des citoyens.
    Si, comme on l’observe en ce moment, la diffusion virale reprend, faut-il dépister plus massivement ou revoir la stratégie de protection de la population ?
    Cette question ne relève pas de la science. Elle dépend des risques acceptables par un individu ou par un groupe. Si on est dans la recherche du risque minimal, proche de zéro, parce que le risque n’a pas été quantifié, ou pour des raisons de responsabilité juridique, on doit prendre les précautions maximales. Si on accepte un risque même faible, on peut reprendre certaines libertés et protéger ceux qui en ont réellement besoin.
    Le scientifique doit mesurer la grandeur des risques et ne pas se contenter d’affirmer qu’un événement adverse est « possible ». Mais ce n’est pas son rôle de décider si ces risques peuvent être pris par autrui.
    Les tests PCR permettent une détection extrêmement sensible de l’ARN viral. Ils sont indispensables mais ne sont pas la solution ultime et unique qui permettra de contrôler l’épidémie et de gérer efficacement les risques de contagion. Appliquée lorsque le virus est largement disséminé dans la population, la stratégie « dépister isoler » est vouée à l’échec. Du fait de la sensibilité très élevée et des limites de leur spécificité, les tests PCR doivent être pratiqués et interprétés avec précaution, et comme toujours en lien avec le contexte clinique et épidémiologique. N’oublions pas qu’un sujet asymptomatique doit plutôt être considéré comme immunisé que comme malade.
    [17] Les tests RT-PCR du Covid-19 se révèlent être de très mauvais tests de contagiosité, Xavier Boisinet, mis à jour le 3/9/2020.
    [18] De nombreuses publications partagées des milliers de fois sur les réseaux sociaux en quelques jours affirment que « 90% » des personnes déclarées positives au Covid-19 ont en fait des charges virales trop basses pour être « malades » ou « contagieuses ». C’est faux.
    [19] Mise au point du CNR sur la réalisation des prélèvements et la sensibilité des tests RT-PCR pour la détection du SARS-CoV-2, 9 mai 2020
    [20] Avis du 25 septembre 2020 de la Société Française de Microbiologie (SFM) relatif à l’interprétation de la valeur de Ct (estimation de la charge virale) obtenue en cas de RT-PCR SARS-CoV-2 positive sur les prélèvements cliniques réalisés à des fins diagnostiques ou de dépistage, 25 septembre 2020
    [21] Coronavirus – Les tests PCR inadaptés contre l’épidémie? « Jusqu’à 90% de personnes testées ne seraient pas contagieuses », basé sur une étude d’une équipe de Harvard ( Harvard TH Chan School of Public Health) de Michael Mina, département d’épidémiologie, je vous mets en fichier joint le PDF correspondant, une étude, reprise par le NY Times :
    « Pour eux, la limite du test PCR (prélèvement par voie nasale ou salivaire) réside dans la brutalité et la simplicité du résultat qu’il donne. La personne est soit positive, soit négative. Pas plus de renseignement, notamment sur la contagiosité du malade.
    Or, les scientifiques d’Harvard soulèvent le problème de la quantité de virus que ce test PCR ne donne pas et qui pourrait, selon eux, permettre de donner des clés supplémentaires pour contrer l’épidémie.
    « Les tests standards diagnostiquent un grand nombre de personnes qui peuvent être porteuses de quantités relativement insignifiantes du virus », explique ainsi le Dr. Michael Mina, épidémiologiste à la Harvard TH Chan School of Public Health
    . »
    [22] « Au rythme actuel avec nos tests RT-PCR, nous allons confiner des dizaines de milliers de gens pour rien », alerte le Dr. Yvon Le Flohic, manuel Moragues, 3 septembre 2020.
    [23] Tests de diagnostic ultra sensibles, les tests RT-PCR sortent positifs même pour des individus qui portent trop peu de virus pour être encore contagieux. Pour en faire de meilleurs tests de contagiosité, certains appellent à baisser leur seuil de détection. Est-ce une bonne idée ? Quelles sont les limites de cette solution ? Décryptage.Xavier Boinivet, 15 septembre 2020
    [24] Jean-Luc Gala (UCL) estime que les futures mesures de la Celeval, tel le lockdown, vont tuer l’économie, provoquer des suicides et déstabiliser l’État. Le Celeval, ou Cellule d’évaluation, est le groupe d’experts qui conseillent le gouvernement belge dans la gestion du COVID.
    [25] L’OMS plaide pour éviter à tout prix les confinements : ‘Cela ne rend que les pauvres plus pauvres’
    [26] Voici comment la pandémie risque de faire exploser la pauvreté mondiale, une première en 22 ans
    [27] ‘Le coronavirus menace 500 millions de personnes de pauvreté’, prévient l’Oxfam. Ce n’est pas le coronavirus, la menace, mais l’attitude de nos gouvernants face au coronavirus !
    [28] Le chômage de masse est désormais mondial
    [29] ‘Nous risquons une crise alimentaire imminente si des mesures ne sont pas prises rapidement’. Encore une fois, ce n’est pas à cause du coronavirus, mais à cause de notre attitude face à cette crise.
    By Dr. Pascal Sacré
    Global Research, February 16, 2021
    Global Research 5 November 2020
    Theme: Science and Medicine
    printme.
    5386 1050 641

    8363
    RT-PCR-pr%C3%A9paration-400x267.
    Introduction: using a technique to lock down society
    All current propaganda on the COVID-19 pandemic is based on an assumption that is considered obvious, true and no longer questioned:

    Positive RT-PCR test means being sick with COVID. This assumption is misleading.
    Very few people, including doctors, understand how a PCR test works.
    RT-PCR means Real Time-Polymerase Chain Reaction.
    In French, it means: Réaction de Polymérisation en Chaîne en Temps Réel.
    In medicine, we use this tool mainly to diagnose a viral infection.
    Starting from a clinical situation with the presence or absence of particular symptoms in a patient, we consider different diagnoses based on tests.
    In the case of certain infections, particularly viral infections, we use the RT-PCR technique to confirm a diagnostic hypothesis suggested by a clinical picture.
    We do not routinely perform RT-PCR on any patient who is overheated, coughing or has an inflammatory syndrome!
    It is a laboratory, molecular biology technique of gene amplification because it looks for gene traces (DNA or RNA) by amplifying them.
    In addition to medicine, other fields of application are genetics, research, industry and forensics.
    The technique is carried out in a specialized laboratory, it cannot be done in any laboratory, even a hospital. This entails a certain cost, and a delay sometimes of several days between the sample and the result.
    Today, since the emergence of the new disease called COVID-19 (COrona VIrus Disease-2019), the RT-PCR diagnostic technique is used to define positive cases, confirmed as SARS-CoV-2 (coronavirus responsible for the new acute respiratory distress syndrome called COVID-19).
    These positive cases are assimilated to COVID-19 cases, some of whom are hospitalized or even admitted to intensive care units.
    Official postulate of our managers: positive RT-PCR cases = COVID-19 patients. [1]
    This is the starting postulate, the premise of all official propaganda, which justifies all restrictive government measures: isolation, confinement, quarantine, mandatory masks, color codes by country and travel bans, tracking, social distances in companies, stores and even, even more importantly, in schools [2].
    This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.
    Technical aspects: to better understand and not be manipulated
    The PCR technique was developed by chemist Kary B. Mullis in 1986. Kary Mullis was awarded the Nobel Prize in Chemistry in 1993.
    Although this is disputed [3], Kary Mullis himself is said to have criticized the interest of PCR as a diagnostic tool for an infection, especially a viral one.
    He stated that if PCR was a good tool for research, it was a very bad tool in medicine, in the clinic [4].
    Mullis was referring to the AIDS virus (HIV retrovirus or HIV) [5], before the COVID-19 pandemic, but this opinion on the limitation of the technique in viral infections [6], by its creator, cannot be dismissed out of hand; it must be taken into account!
    PCR was perfected in 1992.
    As the analysis can be performed in real time, continuously, it becomes RT (Real-Time) – PCR, even more efficient.
    It can be done from any molecule, including those of the living, the nucleic acids that make up the genes:
    • DNA (deoxyribonucleic acid)
    • RNA (Ribonucleic Acid)
    Viruses are not considered as “living” beings, they are packets of information (DNA or RNA) forming a genome.
    It is by an amplification technique (multiplication) that the molecule sought is highlighted and this point is very important.
    RT-PCR is an amplification technique [7].

    If there is DNA or RNA of the desired element in a sample, it is not identifiable as such.
    This DNA or RNA must be amplified (multiplied) a certain number of times, sometimes a very large number of times, before it can be detected. From a minute trace, up to billions of copies of a specific sample can be obtained, but this does not mean that there is all that amount in the organism being tested.
    In the case of COVID-19, the element sought by RT-PCR is SARS-CoV-2, an RNA virus [8].
    There are DNA viruses such as Herpes and Varicella viruses.
    The most well known RNA viruses, in addition to coronaviruses, are Influenza, Measles, EBOLA, ZIKA viruses.
    In the case of SARS-CoV-2, RNA virus, an additional specific step is required, a transcription of RNA into DNA by means of an enzyme, Reverse Transcriptase.
    This step precedes the amplification phase.
    It is not the whole virus that is identified, but sequences of its viral genome.
    This does not mean that this gene sequence, a fragment of the virus, is not specific to the virus being sought, but it is an important nuance nonetheless:
    RT-PCR does not reveal any virus, but only parts, specific gene sequences of the virus.
    At the beginning of the year, the SARS-CoV-2 genome was sequenced.
    It consists of about 30,000 base pairs. The nucleic acid (DNA-RNA), the component of the genes, is a sequence of bases. In comparison, the human genome has more than 3 billion base pairs.
    Teams are continuously monitoring the evolution of the SARS-CoV-2 viral genome as it evolves [9-10-11], through the mutations it undergoes. Today, there are many variants [12].
    By taking a few specific genes from the SARS-CoV-2 genome, it is possible to initiate RT-PCR on a sample from the respiratory tract.
    For COVID-19 disease, which has a nasopharyngeal (nose) and oropharyngeal (mouth) entry point, the sample should be taken from the upper respiratory tract as deeply as possible in order to avoid contamination by saliva in particular.
    rt-pcr-tes. A
    ll the people tested said that it is very painful [13].
    The Gold Standard (preferred site for sampling) is the nasopharyngeal (nasal) approach, the most painful route.
    If there is a contraindication to the nasal approach, or preferably to the individual being tested, depending on the official organs, the oropharyngeal approach (through the mouth) is also acceptable. The test may trigger a nausea/vomiting reflex in the individual being tested.
    Normally, for the result of an RT-PCR test to be considered reliable, amplification from 3 different genes (primers) of the virus under investigation is required.
    “The primers are single-stranded DNA sequences specific to the virus. They guarantee the specificity of the amplification reaction. » [14]​
    “The first test developed at La Charité in Berlin by Dr. Victor Corman and his associates in January 2020 allows to highlight the RNA sequences present in 3 genes of the virus called E, RdRp and N. To know if the sequences of these genes are present in the RNA samples collected, it is necessary to amplify the sequences of these 3 genes in order to obtain a signal sufficient for their detection and quantification. »[15].​
    The essential notion of Cycle Time or Cycle Threshold or Ct positivity threshold [16].
    An RT-PCR test is negative (no traces of the desired element) or positive (presence of traces of the desired element).
    However, even if the desired element is present in a minute, negligible quantity, the principle of RT-PCR is to be able to finally highlight it by continuing the amplification cycles as much as necessary.
    RT-PCR can push up to 60 amplification cycles, or even more!
    Here is how it works:
    Cycle 1: target x 2 (2 copies)
    Cycle 2: target x 4 (4 copies)
    Cycle 3: target x 8 (8 copies)
    Cycle 4: target x 16 (16 copies)
    Cycle 5; target x 32 (32 copies)
    Etc exponentially up to 40 to 60 cycles!
    When we say that the Ct (Cycle Time or Cycle Threshold or RT-PCR positivity threshold) is equal to 40, it means that the laboratory has used 40 amplification cycles, i.e. obtained 240 copies.
    This is what underlies the sensitivity of the RT-PCR assay.
    While it is true that in medicine we like to have high specificity and sensitivity of the tests to avoid false positives and false negatives, in the case of COVID-19 disease, this hypersensitivity of the RT-PCR test caused by the number of amplification cycles used has backfired.
    This over-sensitivity of the RT-PCR test is deleterious and misleading!
    It detaches us from the medical reality which must remain based on the real clinical state of the person: is the person ill, does he or she have symptoms?
    That is the most important thing!
    As I said at the beginning of the article, in medicine we always start from the person: we examine him/her, we collect his/her symptoms (complaints-anamnesis) and objective clinical signs (examination) and on the basis of a clinical reflection in which scientific knowledge and experience intervene, we make diagnostic hypotheses.
    Only then do we prescribe the most appropriate tests, based on this clinical reflection.
    We constantly compare the test results with the patient’s clinical condition (symptoms and signs), which takes precedence over everything else when it comes to our decisions and treatments.
    Today, our governments, supported by their scientific safety advice, are making us do the opposite and put the test first, followed by a clinical reflection necessarily influenced by this prior test, whose weaknesses we have just seen, particularly its hypersensitivity.
    None of my clinical colleagues can contradict me.
    Apart from very special cases such as genetic screening for certain categories of populations (age groups, sex) and certain cancers or family genetic diseases, we always work in this direction: from the person (symptoms, signs) to the appropriate tests, never the other way around.
    This is the conclusion of an article in the Swiss Medical Journal (RMS) published in 2007, written by doctors Katia Jaton and Gilbert Greub microbiologists from the University of Lausanne :
    PCR in microbiology: from DNA amplification to result interpretation:
    “To interpret the result of a PCR, it is essential that clinicians and microbiologists share their experiences, so that the analytical and clinical levels of interpretation can be combined.”​
    It would be indefensible to give everyone an electrocardiogram to screen everyone who might have a heart attack one day.
    On the other hand, in certain clinical contexts or on the basis of specific evocative symptoms, there, yes, an electrocardiogram can be beneficial.
    Back to RT-PCR and Ct (Cycle Time or Cycle Threshold).
    In the case of an infectious disease, especially a viral one, the notion of contagiousness is another important element.
    Since some scientific circles consider that an asymptomatic person can transmit the virus, they believe it is important to test for the presence of virus, even if the person is asymptomatic, thus extending the indication of RT-PCR to everyone.
    Are RT-PCR tests good tests for contagiousness? [17]
    This question brings us back to the notion of viral load and therefore Ct.
    The relationship between contagiousness and viral load is disputed by some people [18] and no formal proof, to date, allows us to make a decision.
    However, common sense gives obvious credence to the notion that the more virus a person has inside him or her, especially in the upper airways (oropharynx and nasopharynx), with symptoms such as coughing and sneezing, the higher the risk of contagiousness, proportional to the viral load and the importance of the person’s symptoms.
    This is called common sense, and although modern medicine has benefited greatly from the contribution of science through statistics and Evidence-Based Medicine (EBM), it is still based primarily on common sense, experience and empiricism.
    Medicine is the art of healing.
    No test measures the amount of virus in the sample!
    RT-PCR is qualitative: positive (presence of the virus) or negative (absence of the virus).
    This notion of quantity, therefore of viral load, can be estimated indirectly by the number of amplification cycles (Ct) used to highlight the virus sought.
    The lower the Ct used to detect the virus fragment, the higher the viral load is considered to be (high).
    The higher the Ct used to detect the virus fragment, the lower the viral load is considered to be (low).
    Thus, the French National Reference Centre (CNR), in the acute phase of the pandemic, estimated that the peak of viral shedding occurred at the onset of symptoms, with an amount of virus corresponding to approximately 108 (100 million) copies of SARS-CoV-2 viral RNA on average (French COVID-19 cohort data) with a variable duration of shedding in the upper airways (from 5 days to more than 5 weeks) [19].
    This number of 108 (100 million) copies/μl corresponds to a very low Ct.
    A Ct of 32 corresponds to 10-15 copies/μl.
    A Ct of 35 corresponds to about 1 copy/μl.
    Above Ct 35, it becomes impossible to isolate a complete virus sequence and culture it!
    In France and in most countries, Ct levels above 35, even 40, are still used even today!
    The French Society of Microbiology (SFM) issued an opinion on September 25, 2020 in which it does not recommend quantitative results, and it recommends to make positive up to a Ct of 37 for a single gene [20]!
    With 1 copy/μl of a sample (Ct 35), without cough, without symptoms, one can understand why all these doctors and scientists say that a positive RT-PCR test means nothing, nothing at all in terms of medicine and clinic!
    Positive RT-PCR tests, without any mention of Ct or its relation to the presence or absence of symptoms, are used as is by our governments as the exclusive argument to apply and justify their policy of severity, austerity, isolation and aggression of our freedoms, with the impossibility to travel, to meet, to live normally!
    There is no medical justification for these decisions, for these governmental choices!
    In an article published on the website of the New York Times (NYT) on Saturday, August 29, American experts from Harvard University are surprised that RT-PCR tests as practiced can serve as tests of contagiousness, even more so as evidence of pandemic progression in the case of SARS-CoV-2 infection [21].
    I’m a Clinical Lab Scientist, COVID-19 Is Fake, Wake Up America!
    According to them, the threshold (Ct) considered results in positive diagnoses in people who do not represent any risk of transmitting the virus!
    The binary “yes/no” answer is not enough, according to this epidemiologist from the Harvard University School of Public Health.
    “It’s the amount of virus that should dictate the course of action for each patient tested. »​
    The amount of virus (viral load); but also and above all the clinical state, symptomatic or not of the person!
    This calls into question the use of the binary result of this RT-PCR test to determine whether a person is contagious and must follow strict isolation measures.
    These questions are being raised by many physicians around the world, not only in the United States but also in France, Belgium (Belgium Health Experts Demand Investigation Of WHO For Faking Coronavirus Pandemic), France, Germany, Italy, the United Kingdom, the United States and the United Kingdom. in Germany, Spain…
    According to them: “We are going to put tens of thousands of people in confinement, in isolation, for nothing. » [22]. 22] And inflict suffering, anguish, economic and psychological dramas by the thousands!
    Most RT-PCR tests set the Ct at 40, according to the NYT. Some set it at 37.
    “Tests with such high thresholds (Ct) may not only detect live virus but also gene fragments, remnants of an old infection that do not represent any particular danger,” the experts said.
    A virologist at the University of California admits that an RT-PCR test with a Ct greater than 35 is too sensitive. “A more reasonable threshold would be between 30 and 35,” she adds.
    Almost no laboratory specifies the Ct (number of amplification cycles performed) or the number of copies of viral RNA per sample μl.
    Here is an example of a laboratory result (approved by Sciensano, the Belgian national reference center) in an RT-PCR negative patient:
    Capture-d%E2%80%99%C3%A9cran-le-2020-10-14-%C3%A0-15.57.40-1024x390.
    No mention of Ct.
    In the NYT, experts compiled three datasets with officials from the states of Massachusetts, New York and Nevada that mention them.
    Conclusion?
    “Up to 90% of the people who tested positive did not carry a virus. »
    The Wadworth Center, a New York State laboratory, analyzed the results of its July tests at the request of the NYT: 794 positive tests with a Ct of 40.
    “With a Ct threshold of 35, approximately half of these PCR tests would no longer be considered positive,” said the NYT.
    “And about 70% would no longer be considered positive with a Ct of 30! “
    In Massachusetts, between 85 and 90% of people who tested positive in July with a Ct of 40 would have been considered negative with a Ct of 30, adds the NYT. And yet, all these people had to isolate themselves, with all the dramatic psychological and economic consequences, while they were not sick and probably not contagious at all.
    In France, the Centre National de Référence (CNR), the French Society of Microbiology (SFM) continue to push Ct to 37 and recommend to laboratories to use only one gene of the virus as a primer.
    I remind you that from Ct 32 onwards, it becomes very difficult to culture the virus or to extract a complete sequence, which shows the completely artificial nature of this positivity of the test, with such high Ct levels, above 30.
    Similar results were reported by researchers from the UK Public Health Agency in an article published on August 13 in Eurosurveillance: “The probability of culturing the virus drops to 8% in samples with Ct levels above 35.” [23]
    In addition, currently, the National Reference Center in France only evaluates the sensitivity of commercially available reagent kits, not their specificity: serious doubts persist about the possibility of cross-reactivity with viruses other than SARS-CoV-2, such as other benign cold coronaviruses. [20]
    It is potentially the same situation in other countries, including Belgium.
    Similarly, mutations in the virus may have invalidated certain primers (genes) used to detect SARS-CoV-2: the manufacturers give no guarantees on this, and if the AFP fast-checking journalists tell you otherwise, test their good faith by asking for these guarantees, these proofs.
    If they have nothing to hide and if what I say is false, this guarantee will be provided to you and will prove their good faith.
    1. We must demand that the RT-PCR results be returned mentioning the Ct used because beyond Ct 30, a positive RT-PCR test means nothing.
    2. We must listen to the scientists and doctors, specialists, virologists who recommend the use of adapted Ct, lower, at 30. An alternative is to obtain the number of copies of viral RNA/μl or /ml sample. [23]
    3. We need to go back to the patient, to the person, to his or her clinical condition (presence or absence of symptoms) and from there to judge the appropriateness of testing and the best way to interpret the result.
    Until there is a better rationale for PCR screening, with a known and appropriate Ct threshold, an asymptomatic person should not be tested in any way.
    Even a symptomatic person should not automatically be tested, as long as they can place themselves in isolation for 7 days.
    Let’s stop this debauchery of RT-PCR testing at too high Ct levels and return to clinical, quality medicine.
    Once we understand how RT-PCR testing works, it becomes impossible to let the current government routine screening strategy, inexplicably supported by the virologists in the safety councils, continue.
    My hope is that, finally, properly informed, more and more people will demand that this strategy be stopped, because it is all of us, enlightened, guided by real benevolence and common sense, who must decide our collective and individual destinies.
    No one else should do it for us, especially when we realize that those who decide are no longer reasonable or rational.
    Summary of important points :
    • The RT-PCR test is a laboratory diagnostic technique that is not well suited to clinical medicine.
    • It is a binary, qualitative diagnostic technique that confirms (positive test) or not (negative test) the presence of an element in the medium being analyzed. In the case of SARS-CoV-2, the element is a fragment of the viral genome, not the virus itself.
    • In medicine, even in an epidemic or pandemic situation, it is dangerous to place tests, examinations, techniques above clinical evaluation (symptoms, signs). It is the opposite that guarantees quality medicine.
    • The main limitation (weakness) of the RT-PCR test, in the current pandemic situation, is its extreme sensitivity (false positive) if a suitable threshold of positivity (Ct) is not chosen. Today, experts recommend using a maximum Ct threshold of 30.
    • This Ct threshold must be informed with the positive RT-PCR result so that the physician knows how to interpret this positive result, especially in an asymptomatic person, in order to avoid unnecessary isolation, quarantine, psychological trauma.
    • In addition to mentioning the Ct used, laboratories must continue to ensure the specificity of their detection kits for SARS-CoV-2, taking into account its most recent mutations, and must continue to use three genes from the viral genome being studied as primers or, if not, mention it.

    Overall Conclusion
    Is the obstinacy of governments to use the current disastrous strategy, systematic screening by RT-PCR, due to ignorance?
    Is it due to stupidity?
    To a kind of cognitive trap trapping their ego?
    In any case, we should be able to question them, and if among the readers of this article there are still honest journalists, or naive politicians, or people who have the possibility to question our rulers, then do so, using these clear and scientific arguments.
    It is all the more incomprehensible that our rulers have surrounded themselves with some of the most experienced specialists in these matters.
    If I have been able to gather this information myself, shared, I remind you, by competent people above all suspicion of conspiracy, such as Hélène Banoun, Pierre Sonigo, Jean-François Toussaint, Christophe De Brouwer, whose intelligence, intellectual honesty and legitimacy cannot be questioned, then the Belgian, French and Quebec scientific advisors, etc., know all this as well.
    So?
    What’s going on?
    Why continue in this distorted direction, obstinately making mistakes?
    It is not insignificant to reimpose confinements, curfews, quarantines, reduced social bubbles, to shake up again our shaky economies, to plunge entire families into precariousness, to sow so much fear and anxiety generating a real state of post-traumatic stress worldwide, to reduce access to care for other pathologies that nevertheless reduce life expectancy much more than COVID-19! [24]
    Is there intent to harm?
    Is there an intention to use the alibi of a pandemic to move humanity towards an outcome it would otherwise never have accepted? In any case, not like that!
    Would this hypothesis, which modern censors will hasten to label “conspiracy”, be the most valid explanation for all this?

    Indeed, if we draw a straight line from the present events, if they are maintained, we could find ourselves once again confined with hundreds, thousands of human beings forced to remain inactive, which, for the professions of catering, entertainment, sales, fairgrounds, itinerants, canvassers, risks being catastrophic with bankruptcies, unemployment, depression, suicides by the hundreds of thousands. [25-26-27-28]
    The impact on education, on our children, on teaching, on medicine with long planned care, operations, treatments to be cancelled, postponed, will be profound and destructive.
    “We risk a looming food crisis if action is not taken quickly.” [29].
    It is time for everyone to come out of this negative trance, this collective hysteria, because famine, poverty, massive unemployment will kill, mow down many more people than SARS-CoV-2!
    Does all this make sense in the face of a disease that is declining, over-diagnosed and misinterpreted by this misuse of overly sensitively calibrated PCR tests?
    For many, the continuous wearing of the mask seems to have become a new norm.
    Even if it is constantly downplayed by some health professionals and fact-checking journalists, other doctors warn of the harmful consequences, both medical and psychological, of this hygienic obsession which, maintained permanently, is in fact an abnormality!
    What a hindrance to social relations, which are the true foundation of a physically and psychologically healthy humanity!
    Some dare to find all this normal, or a lesser price to pay in the face of the pandemic of positive PCR tests.
    Isolation, distancing, masking of the face, impoverishment of emotional communication, fear of touching and kissing even within families, communities, between relatives…
    Spontaneous gestures of daily life hindered and replaced by mechanical and controlled gestures …
    Terrified children, kept in permanent fear and guilt…
    All this will have a deep, lasting and negative impact on human organisms, in their physical, mental, emotional and representation of the world and society.
    This is not normal!
    We cannot let our rulers, for whatever reason, organize our collective suicide any longer.
    Translated from French by Global Research. Original source: Mondialisation.ca
    Dr Pascal Sacré is a physician specialized in critical care, author and renowned public health analyst, Charleroi, Belgium. He is a Research Associate of the entre for Research on Globalization (CRG)

    ****
    Professionals whose references and comments are the basis of this article in its scientific aspect (especially and mainly on RT-PCR):
    1) Hélène Banoun

    https://www.researchgate.net/profile/Helene_Banoun
    PhD, Pharmacist biologist
    Former INSERM Research Officer
    Former intern at the Paris Hospitals
    2) Pierre Sonigo
    Virologist
    Research Director INSERM, worked at the Pasteur Institute
    Heads the Virus Genetics Laboratory in Cochin, Paris.
    Participated in 1985 in the sequencing of the AIDS virus.
    3) Christophe De Brouwer
    PhD in Public Health Science
    Honorary Professor at the School of Public Health at ULB, Belgium
    4) Jean-François Toussaint
    Doctor, Professor of Physiology at the University of Paris-Descartes
    Director of IRMES, Institute for BioMedical Research and Sports Epidemiology
    Former member of the High Council of Public Health
    ***
    Notes (French)
    [1] “Une nette augmentation du nombre de cas dans toutes les provinces et toutes les tranches d’âge”, 7sur7 ACTU Belgique, 5-10-2020
    [2] Le gouvernement belge renforce des mesures anti-Covid, VRT.be ; 6 octobre 2020.
    [3] Non, l’inventeur du test PCR n’a pas dit que sa méthode était inefficace pour détecter les virus, dans Le Monde, 7 octobre 2020
    [4] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.
    [5] https://www.weblyf.com/2020/05/coro...test-kit-from-the-inventor-and-other-experts/
    [6] « The Truth about PCR Test Kit from the Inventor and Other Experts »
    [7] PCR en microbiologie : de l’amplification de l’ADN à l’interprétation du résultat
    [8] COVID : La PCR nasale peut-elle mentir ?, Dr Pascal Sacré, AIMSIB, 30 août 2020.
    [9]
    View: https://www.youtube.com/watch?v=CaAcSJI0oMs&feature=youtu.be
    , 8 octobre 2020. Évolution génomique des virus ARN à l’Institut Pasteur, environ la moitié des nucléotides sont susceptibles d’avoir muté sur les 30 000 nucléotides de l’ARN viral. « Pour l’instant aucune mutation ou délétion n’a été associée à une perte de sévérité de la maladie sur une grande échelle géographique mais de nombreuses publications devraient bientôt préciser ces points. »
    [10] https://www.mediterranee-infection....0/04/FD_Raoult_SARS-CoV-2_EID_Sep2020_vL2.pdf, Article IHU-Méditerranée, Professeur D. Raoult, Dramatic increase in the SARS-CoV-2 mutation rate and low mortality rate during the second epidemic in summer in Marseille, 7 septembre 2020
    Conclusions :
    Dans l’ensemble, comme l’ont récemment souligné Tomaszewski et al. (7) qui ont décrit pour les génomes viraux disponibles jusqu’en mai 2020 un déplacement mutationnel sur la spike et le complexe de réplication vers des gènes codant pour d’autres protéines non structurelles qui interagissent avec les voies de défense de l’hôte, il semble que le taux de mutation du SARS-CoV-2 s’accélère depuis mai, impliquant principalement des mutations C vers U. L’augmentation du taux de mutation du SRAS-CoV-2 génère des génotypes viraux plus éloignés de la souche Wuhan initiale que ceux observés de mars à avril. Cela semble entraîner des épidémies de durée limitée, du moins pour le premier nouveau génotype que nous avons identifié, et est associé à une gravité globalement moindre à ce stade du développement de cette nouvelle épidémie.
    Mutations observed in these seven different viral genotypes are located in most SARS- CoV-2 genes including structural and non-structural genes among which nsp2, nsp3 (predicted phosphoesterase), nsp5 (membrane glycoprotein), nsp12 (RNA-dependent RNA polymerase), S (Spike glycoprotein), ORF3a, E (membrane glycoprotein), M (membrane glycoprotein), ORF8 and N (Nucleocapsid phosphoprotein).
    [11] https://www.researchgate.net/profile/Helene_Banoun Evolution of SARS-CoV-2: Review of mutations, role of the host immune system, octobre 2020, mise à jour par Hélène Banoun,
    PhD, Pharmacien biologiste, ancien Chargé de Recherches INSERM, ancien Interne des Hôpitaux de Paris.
    [12] https://nextstrain.org/, We are incorporating SARS-CoV-2 genomes as soon as they are shared and providing analyses and situation reports. In addition we have developed a number of resources and tools, and are facilitating independent groups to run their own analysis. Please see the main SARS-CoV-2 page for more.
    [13] Tutoriel prélèvement nasopharyngé : Un geste technique, essentiel à la fiabilité du test COVID-19
    [14] Covid-19 : comment fonctionnent les tests et quelles sont leurs utilités ?
    [15] COMMENT FONCTIONNENT LES TESTS DE DÉPISTAGE DU COVID-19 ? 7 avril 2020, Laboratoire de biologie et pharmacologie appliquée (LBPA), Clémence Richetta, maître de conférences au département biologie de l’ENS Paris-Saclay et chercheuse en virologie au LBPA :
    View: https://www.youtube.com/watch?v=hNVDHCf8bGA

    Independent researcher, PhD 9
    Former research fellow at INSERM (French Institute for Health and Medical Research)
    [16] Par Pierre Sonigo, virologiste (un des découvreurs du VIH), MD PhD, CSO at Sebia, clinical diagnostics
    https://www.linkedin.com/pulse/diagnostic-du-covid19-comprendre-les-tests-pcr-leur-et-pierre-sonigo/?trackingId=pTYxDkpvRzKHWZwCzxSIag%3D%3D
    Diagnostic du COVID19 : comprendre les tests PCR, leur interprétation et leurs limites, publié le 16 septembre 2020
    La PCR utilise un principe très particulier : la cible du test, un fragment d’ARN viral, est massivement amplifiée afin de permettre sa détection. Au cours de l’analyse, une réaction enzymatique associée à des « cycles » de variation de température permet une série de « réplications » successives de l’acide nucléique cible. Chaque cycle correspond à une multiplication théorique de la cible par 2. On multiplie donc par 2 en un cycle, par 4 en 2 cycles, par 8 en 3 cycles, par 16 en 4 cycles, et ainsi de suite de manière exponentielle. A l’heure actuelle, l’amplification est généralement pratiquée sur 40 cycles, soit une amplification théorique de 2^40, environ mille milliards de fois ! En réalité, la réplication n’est pas efficace à 100%, mais la cible est amplifiée environ un million de fois, ce qui permet de détecter moins d’une dizaine de fragments d’ARN dans le volume analysé.
    Lorsque l’acide nucléique viral est détectable après un petit nombre de cycles, cela signifie que la quantité de virus dans l’échantillon de départ est grande. Au contraire, lorsqu’il faut un grand nombre de cycles de réplication pour détecter l’ARN viral, cela signifie que l’échantillon de départ contient une quantité de virus très faible. On parle alors en nombre de cycles, ou Ct, qui signifie « cycle time », pour définir, au moins de façon semi quantitative, la quantité d’ARN présent dans l’échantillon de départ. Ainsi, un petit Ct correspond à un grand nombre de copies, un grand Ct à un petit nombre de copies.
    Cette spectaculaire sensibilité n’est pas sans inconvénient et nécessite des précautions particulières. En effet, un échantillon positif amplifié un million de fois contient une très haute concentration de cible et le risque qu’il contamine (carry over) d’autres échantillons est particulièrement élevé. La saturation des laboratoires peut encore accroître ce risque et générer des faux positifs accidentels. Dans ces conditions, il est important que les résultats positifs soient confirmés par un second test, à plus forte raison lorsqu’un test positif présente des conséquences significatives, qu’elles soient médicales, professionnelles ou liées à l’obligation d’isolement.
    La deuxième question importante concernant la PCR, une fois encore conséquence de sa spectaculaire sensibilité, est celle de sa signification clinique. Un sujet parfaitement asymptomatique présentant une PCR positive ne peut être qualifié de « malade », comme on le lit dans les médias qui rapportent la progression de l’épidémie ! Peut-on même parler de « cas » ? C’est pourtant le terme utilisé dans les dénombrements officiels. Ne sommes-nous pas en train d’oublier le patient pour se focaliser sur la technologie ? Est-ce une épidémie d’ARN dans des tubes que nous surveillons ou une maladie grave et potentiellement mortelle ?
    Des publications récentes soulignent que la dose détectable par PCR est inférieure à la dose infectieuse ou contagieuse : aucun virus infectieux n’a pu être retrouvé chez les patients asymptomatiques présentant des tests PCR positifs avec un Ct élevé. Suite à ces résultats, la question du seuil de Ct qui permet de déclarer un échantillon positif est débattue. Peut-on rendre un résultat négatif chez un sujet asymptomatique dont la positivité apparaît au-delà de 35 cycles ? A défaut, est-il utile de retester ces échantillons ? Comme souvent en matière de diagnostic médical, lorsqu’un seuil de positivité est déterminé, faut-il privilégier la sensibilité ou la spécificité du test ?
    De plus, un échantillon confirmé positif d’un point de vue analytique reste un faux positif du point de vue de la clinique, si la personne testée est en parfaite santé, parfois même prêt à affronter une compétition de tennis ou de football professionnels ! La question devient uniquement celle de sa potentielle contagiosité. C’est la question de la transmission éventuelle par des sujets asymptomatiques, qui sans être eux-mêmes en danger, pourraient en représenter un pour les autres.
    Par rapport à cette question, il est important de raisonner quantitativement. La virologie, ce n’est pas du tout ou rien. De manière générale, au cours des infections virales aiguës, le risque de contagion et la gravité de l’infection varient en fonction de la quantité de virus présents dans l’organisme et de leur excrétion dans le milieu extérieur. Quelques copies de virus tapis dans les sinus n’ont pas la dangerosité d’un million projetés par la toux. Un sujet asymptomatique produit moins de virus qu’un sujet symptomatique et les sécrète moins vers l’extérieur. La quantité de virus produite et donc le risque de contagion sont corrélés à la gravité des symptômes. Même si elle n’est pas de zéro, le risque de transmission est donc vraisemblablement faible pour un sujet asymptomatique. Malheureusement, répéter sans cesse que la contagion venant d’un sujet parfaitement asymptomatique est possible sans aucune précision sur le niveau de risque pousse à prendre des mesures disproportionnées avec le risque.
    De même, la stratégie « dépister-isoler » n’est pas réaliste lorsque le dépistage n’est pas suffisamment fiable et surtout lorsque le virus est déjà largement répandu dans la population. Il est bien trop tard pour appliquer une méthode conçue pour bloquer une épidémie à sa naissance. Comme pour une invasion de coccinelles ou de frelons, on ne peut stopper un virus qui est déjà partout avec une passoire trouée à 25% et bouchée par endroits. L’échec de la stratégie actuelle est plutôt lié à sa conception naïve et inapplicable qu’aux mauvais comportements des citoyens.
    Si, comme on l’observe en ce moment, la diffusion virale reprend, faut-il dépister plus massivement ou revoir la stratégie de protection de la population ?
    Cette question ne relève pas de la science. Elle dépend des risques acceptables par un individu ou par un groupe. Si on est dans la recherche du risque minimal, proche de zéro, parce que le risque n’a pas été quantifié, ou pour des raisons de responsabilité juridique, on doit prendre les précautions maximales. Si on accepte un risque même faible, on peut reprendre certaines libertés et protéger ceux qui en ont réellement besoin.
    Le scientifique doit mesurer la grandeur des risques et ne pas se contenter d’affirmer qu’un événement adverse est « possible ». Mais ce n’est pas son rôle de décider si ces risques peuvent être pris par autrui.
    Les tests PCR permettent une détection extrêmement sensible de l’ARN viral. Ils sont indispensables mais ne sont pas la solution ultime et unique qui permettra de contrôler l’épidémie et de gérer efficacement les risques de contagion. Appliquée lorsque le virus est largement disséminé dans la population, la stratégie « dépister isoler » est vouée à l’échec. Du fait de la sensibilité très élevée et des limites de leur spécificité, les tests PCR doivent être pratiqués et interprétés avec précaution, et comme toujours en lien avec le contexte clinique et épidémiologique. N’oublions pas qu’un sujet asymptomatique doit plutôt être considéré comme immunisé que comme malade.
    [17] Les tests RT-PCR du Covid-19 se révèlent être de très mauvais tests de contagiosité, Xavier Boisinet, mis à jour le 3/9/2020.
    [18] De nombreuses publications partagées des milliers de fois sur les réseaux sociaux en quelques jours affirment que « 90% » des personnes déclarées positives au Covid-19 ont en fait des charges virales trop basses pour être « malades » ou « contagieuses ». C’est faux.
    [19] Mise au point du CNR sur la réalisation des prélèvements et la sensibilité des tests RT-PCR pour la détection du SARS-CoV-2, 9 mai 2020
    [20] Avis du 25 septembre 2020 de la Société Française de Microbiologie (SFM) relatif à l’interprétation de la valeur de Ct (estimation de la charge virale) obtenue en cas de RT-PCR SARS-CoV-2 positive sur les prélèvements cliniques réalisés à des fins diagnostiques ou de dépistage, 25 septembre 2020
    [21] Coronavirus – Les tests PCR inadaptés contre l’épidémie? « Jusqu’à 90% de personnes testées ne seraient pas contagieuses », basé sur une étude d’une équipe de Harvard ( Harvard TH Chan School of Public Health) de Michael Mina, département d’épidémiologie, je vous mets en fichier joint le PDF correspondant, une étude, reprise par le NY Times :
    « Pour eux, la limite du test PCR (prélèvement par voie nasale ou salivaire) réside dans la brutalité et la simplicité du résultat qu’il donne. La personne est soit positive, soit négative. Pas plus de renseignement, notamment sur la contagiosité du malade.
    Or, les scientifiques d’Harvard soulèvent le problème de la quantité de virus que ce test PCR ne donne pas et qui pourrait, selon eux, permettre de donner des clés supplémentaires pour contrer l’épidémie.
    « Les tests standards diagnostiquent un grand nombre de personnes qui peuvent être porteuses de quantités relativement insignifiantes du virus », explique ainsi le Dr. Michael Mina, épidémiologiste à la Harvard TH Chan School of Public Health
    . »
    [22] « Au rythme actuel avec nos tests RT-PCR, nous allons confiner des dizaines de milliers de gens pour rien », alerte le Dr. Yvon Le Flohic, manuel Moragues, 3 septembre 2020.
    [23] Tests de diagnostic ultra sensibles, les tests RT-PCR sortent positifs même pour des individus qui portent trop peu de virus pour être encore contagieux. Pour en faire de meilleurs tests de contagiosité, certains appellent à baisser leur seuil de détection. Est-ce une bonne idée ? Quelles sont les limites de cette solution ? Décryptage.Xavier Boinivet, 15 septembre 2020
    [24] Jean-Luc Gala (UCL) estime que les futures mesures de la Celeval, tel le lockdown, vont tuer l’économie, provoquer des suicides et déstabiliser l’État. Le Celeval, ou Cellule d’évaluation, est le groupe d’experts qui conseillent le gouvernement belge dans la gestion du COVID.
    [25] L’OMS plaide pour éviter à tout prix les confinements : ‘Cela ne rend que les pauvres plus pauvres’
    [26] Voici comment la pandémie risque de faire exploser la pauvreté mondiale, une première en 22 ans
    [27] ‘Le coronavirus menace 500 millions de personnes de pauvreté’, prévient l’Oxfam. Ce n’est pas le coronavirus, la menace, mais l’attitude de nos gouvernants face au coronavirus !
    [28] Le chômage de masse est désormais mondial
    [29] ‘Nous risquons une crise alimentaire imminente si des mesures ne sont pas prises rapidement’. Encore une fois, ce n’est pas à cause du coronavirus, mais à cause de notre attitude face à cette crise.

    SEE ARTICLE HERE:
    The COVID-19 RT-PCR Test:

    How to Mislead All Humanity.

    Using a “Test” To Lock Down Society


    It is time for everyone to come out of this negative trance,

    this collective hysteria, because famine, poverty,

    massive unemployment will kill,

    mow down many more people than SARS-CoV-2!



    The COVID-19 RT-PCR Test: How to Mislead All Humanity. Using a "Test" To Lock Down Society - Global ResearchGlobal Research - Centre for Research on Globalization
    https://www.globalresearch.ca/covid...ity-using-a-test-to-lock-down-society/5728483
     
  9. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    The Scam Has Been Confirmed:

    PCR Does Not Detect SARS-CoV-2


    https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2

    The Scam Has Been Confirmed: PCR Does Not Detect SARS-CoV-2
    Views 132538
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    [​IMG]
    Posted on:
    Monday, December 14th 2020 at 10:45 am
    Posted By:
    GMI Reporter
    The_Scam_Has_Been_Confirmed-PCR_Does_Not_Detect_SARS-CoV-2-GreenMedInfo.
    Unofficial English translation of 'Frauds and falsehoods in the medical field' originally published on www.dsalud.com​
    The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed "genome" and even the so-called "target genes" allegedly specific to the "new coronavirus". The test is worthless and all "positive" results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world's leading experts on PCR, in fact says that under certain conditions anyone can test positive!
    We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report "Can you prove that there are pathogenic viruses?" on our website -www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.

    We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive.
    In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the "human coronaviruses". And the conclusions are extremely serious: none of the seven "human coronaviruses" have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.


    We are going to explain step by step the research that has led us to such an unusual conclusion.


    HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?
    During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on "isolates" of previous "human coronaviruses", we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:
    Coronavirus 229E.
    Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.
    Since the authors refer to other articles to explain the method of isolation - which they call Complement Fixation - we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.
    Coronavirus OC43.
    Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.
    What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus. The tool used - a QIAamp kit - removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a "virus" is being worked with.


    SARS-CoV Coronavirus.
    Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.
    There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that "the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients". There are no controls. The only mention is of a "cytopathic effect" that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with "random initiators" and a sequence "of unknown origin" is detected to which "a weak homology with the coronaviridiae family" is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.
    Coronavirus NL63.
    Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.
    The authors state that "the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed".
    What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let's see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of "cytopathic effect". The novelty introduced by this method is that "restriction enzymes" are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are "virus-like particles", "retrovirus-like particles", "endogenous retroviruses", "exosomes", "extracellular" particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as "viruses" and therefore can falsify results by producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that "no redundancy is expected in the VIDISCA insert from the host background nucleic acid except in the case of 'virus-like' characteristics, i.e., high copy numbers as in mitochondrial DNA.


    Coronavirus HKU1.
    Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.
    The article, incredibly, begins with these words: "Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures." And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out "predictions" on how nucleotides should be combined. The text adds: "The sequences were manually assembled and edited to produce a final sequence of the viral genome". And once again there are no controls.
    MERS-CoV Coronavirus.

    Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.


    The genetic material is extracted directly from the culture supernatant and sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls.
    In short, what had been done with the first coronaviruses -and with many other supposed viruses- is to cultivate supposedly infected tissues - any "cytopathic effect" was attributed to the presence of a virus only - and then either some proteins are obtained which without any test are considered "virus antigens" and when these "antigens" are detected in cultures it is interpreted as "isolation", or fragments of nucleic acids are extracted assuming that they belong to a virus.
    We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called "cytopathic effect" is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others
    (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf It explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintock-lecture.pdf
    In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

    And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses" cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on the presumed components of these "viruses" (nucleic acids or proteins) are completely disqualified as "infection tests" and even more as "diagnostics" of diseases.


    MORE UNANSWERED REQUESTS
    In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not "purified" which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities - political and health - from various countries about the purification and isolation of SARS-CoV-2.
    James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm- tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that "it has no records that could provide an answer to their request". The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: "The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act". It follows from the NVR's request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having "detected SARS-CoV-2 RNA in diagnostic samples."
    On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn - professor at Imperial College London -, the engineer and independent researcher - who we interviewed in the journal at the time - David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick - and to this day they still have not received a reply!
    Another similar request - in this case to the National Research Council of Canada - received the following response: "We have not been able to carry out a complete search of the NRC's records so we regret to inform you that no records have been identified that respond to your request."
    We will add that two journalists have been sending similar requests - under the Freedom of Information Act - to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at
    https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-covid-19-virus-isolation/


    LOOKING FOR THE ORIGIN OF THE FALSE GENOME
    The question we asked ourselves then was: if the sequences that have been published do not belong - as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.
    First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:
    • China CDC protocol: uses ORF1ab and N genes as target.
    • Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
    • United States CDC protocol: uses three fragments of the N gene.
    • Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
    • Charite Protocol (Germany): uses the E, N and RdRP genes.
    • Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
    • National Institute of Health Thailand protocol: uses the N gene.
    We then introduced the sequence of the primers - the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.
    THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!


    Let's see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.
    We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.
    And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!
    We then decided to repeat the operation but with the final or reverse primer - which is CTCCCTTTGTGTGTGT - and the results were similar.
    Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903. Once there, we located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one:


    ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.
    With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our own genome.
    Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:
    ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCGATTCTGGTCTAA.
    We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.
    We finally decided to test with the S gene which is said to generate the structural "spike" proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS-CoV-2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene and the first - TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe sequences and 93 sequences of the human genome and the second - CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human genome.
    Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once


    again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!
    CONCLUSIONS

    The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that
    ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES" ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.
    We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 - it is available at https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve - and it literally says on page 5: "Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target". That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2.
    That is not all because the manual later states, "An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used."
    The WHO manual states, "One or more negative results do not necessarily rule out SARS-CoV-2 infection. There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR."
    What are the judges waiting for to act on their own initiative?


    Jesus Garcia Blanca

    Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST.
    THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)
    Disclaimer: This article is not intended to provide medical advice, diagnosis or treatment. Views expressed here do not necessarily reflect those of GreenMedInfo or its staff.


    The Scam Has Been Confirmed:

    PCR Does Not Detect SARS-CoV-2


    https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2
     
  10. CULCULCAN

    CULCULCAN The Final Synthesis - isbn 978-0-9939480-0-8 Staff Member

    Messages:
    55,227
    CRAZYONE.JPG
     

Share This Page